Incidental Mutation 'R7964:Trappc11'
ID650272
Institutional Source Beutler Lab
Gene Symbol Trappc11
Ensembl Gene ENSMUSG00000038102
Gene Nametrafficking protein particle complex 11
SynonymsD030016E14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7964 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location47490115-47533470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47526944 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 186 (I186L)
Ref Sequence ENSEMBL: ENSMUSP00000047562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039061
AA Change: I186L

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: I186L

DomainStartEndE-ValueType
Pfam:Foie-gras_1 263 522 3e-78 PFAM
Pfam:Gryzun 978 1114 3.9e-10 PFAM
Pfam:Gryzun-like 1036 1095 2.4e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,298,234 R2102L unknown Het
Abca13 A T 11: 9,316,146 M3042L probably benign Het
Abca3 T A 17: 24,402,436 L1345Q probably benign Het
Adam20 G T 8: 40,796,907 V685F probably damaging Het
Adam25 T A 8: 40,755,539 I614N probably damaging Het
Aldh1a7 C T 19: 20,700,007 V417M probably damaging Het
Aldh1a7 C T 19: 20,716,042 G171D probably benign Het
Aloxe3 T C 11: 69,126,536 F45S probably damaging Het
Ankrd26 T C 6: 118,523,199 I1104V probably benign Het
Ap3d1 C A 10: 80,730,057 R92L probably damaging Het
Aspm A G 1: 139,480,686 Q2437R probably damaging Het
Bcl11a T C 11: 24,163,353 I232T probably benign Het
Cfap97 A G 8: 46,170,200 D209G possibly damaging Het
Csmd2 A G 4: 128,523,510 M2754V Het
Dcdc2c A G 12: 28,470,319 I586T Het
Dkk4 T C 8: 22,625,352 C73R probably damaging Het
Dzip3 T C 16: 48,951,905 D467G probably damaging Het
Eif5 T C 12: 111,540,174 F67L probably benign Het
Elmod1 A G 9: 53,931,576 I100T probably benign Het
Gm9837 A G 11: 53,470,174 L71P unknown Het
Hpse A G 5: 100,698,911 probably null Het
Insc T C 7: 114,846,473 L472P probably damaging Het
Itgax A C 7: 128,140,418 probably null Het
Lair1 A G 7: 4,010,804 V148A probably benign Het
Lama2 A G 10: 27,223,981 probably null Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lgr5 T C 10: 115,452,174 D855G probably benign Het
Lrp1 C A 10: 127,575,044 R1425L possibly damaging Het
Lrp1b A G 2: 40,598,511 S4521P Het
Nbas A G 12: 13,356,895 Y831C probably damaging Het
Nek9 C A 12: 85,339,013 R70L probably benign Het
Nlrp2 A C 7: 5,328,528 L290V probably damaging Het
Nos1 T A 5: 117,900,542 I480N probably damaging Het
Olfr1253 T C 2: 89,752,814 N5D possibly damaging Het
Pcdhb13 C A 18: 37,444,818 Q750K possibly damaging Het
Pik3c2g C T 6: 139,882,060 T727I Het
Pik3r6 C A 11: 68,533,739 P390Q probably benign Het
Pramel1 T C 4: 143,397,240 S162P probably benign Het
Psg21 A G 7: 18,647,211 M469T probably benign Het
Psg27 A T 7: 18,565,199 W66R probably damaging Het
Sbno2 A G 10: 80,068,351 C371R probably damaging Het
Shroom1 G T 11: 53,464,322 K329N possibly damaging Het
Slc35a3 A G 3: 116,687,335 I93T possibly damaging Het
Slc38a2 G A 15: 96,692,572 T297M probably benign Het
Sorl1 T A 9: 41,991,401 D1620V probably damaging Het
Srsf4 T A 4: 131,891,233 L45Q probably benign Het
Tcaf2 G A 6: 42,629,706 S438L probably benign Het
Tmem2 T C 19: 21,798,430 probably null Het
Usp9y A T Y: 1,316,914 N1878K probably benign Het
Wdr63 T C 3: 146,068,776 N439D probably benign Het
Zfp280d T A 9: 72,322,458 M349K probably damaging Het
Zgpat A G 2: 181,378,481 H227R probably benign Het
Other mutations in Trappc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Trappc11 APN 8 47503302 unclassified probably benign
IGL01300:Trappc11 APN 8 47501868 missense probably benign
IGL01312:Trappc11 APN 8 47505677 missense possibly damaging 0.95
IGL01344:Trappc11 APN 8 47519704 missense probably damaging 1.00
IGL01518:Trappc11 APN 8 47501869 splice site probably null
IGL01747:Trappc11 APN 8 47519621 missense probably benign 0.41
IGL01781:Trappc11 APN 8 47514128 missense possibly damaging 0.95
IGL01908:Trappc11 APN 8 47503994 missense probably damaging 1.00
IGL01956:Trappc11 APN 8 47528001 missense possibly damaging 0.86
IGL02266:Trappc11 APN 8 47505731 missense probably damaging 1.00
IGL02377:Trappc11 APN 8 47530650 critical splice donor site probably null
IGL02530:Trappc11 APN 8 47507582 missense probably damaging 1.00
IGL02676:Trappc11 APN 8 47493413 splice site probably benign
IGL03030:Trappc11 APN 8 47513929 missense probably damaging 0.98
IGL03393:Trappc11 APN 8 47510877 missense possibly damaging 0.95
bunyoro UTSW 8 47512285 splice site probably null
nyoro UTSW 8 47526979 missense possibly damaging 0.73
serval UTSW 8 47503965 missense probably damaging 1.00
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0043:Trappc11 UTSW 8 47505575 splice site probably benign
R0180:Trappc11 UTSW 8 47527974 missense possibly damaging 0.86
R0529:Trappc11 UTSW 8 47526979 missense possibly damaging 0.73
R0538:Trappc11 UTSW 8 47503412 missense probably benign 0.01
R0740:Trappc11 UTSW 8 47524588 missense probably damaging 0.99
R1352:Trappc11 UTSW 8 47525046 missense possibly damaging 0.90
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1502:Trappc11 UTSW 8 47530827 missense possibly damaging 0.94
R1589:Trappc11 UTSW 8 47501680 missense probably damaging 1.00
R1741:Trappc11 UTSW 8 47529327 critical splice donor site probably null
R2292:Trappc11 UTSW 8 47505736 missense probably damaging 1.00
R2303:Trappc11 UTSW 8 47503416 missense probably damaging 0.99
R2931:Trappc11 UTSW 8 47503942 missense probably damaging 0.99
R3522:Trappc11 UTSW 8 47498673 missense possibly damaging 0.93
R3714:Trappc11 UTSW 8 47505316 intron probably benign
R3739:Trappc11 UTSW 8 47514103 missense probably damaging 0.98
R4165:Trappc11 UTSW 8 47524968 splice site probably benign
R4581:Trappc11 UTSW 8 47493345 missense probably damaging 0.97
R4598:Trappc11 UTSW 8 47513766 missense probably damaging 0.98
R4939:Trappc11 UTSW 8 47519665 missense probably damaging 1.00
R4990:Trappc11 UTSW 8 47490895 missense probably benign 0.41
R4994:Trappc11 UTSW 8 47522441 nonsense probably null
R5091:Trappc11 UTSW 8 47512604 missense probably benign 0.00
R5123:Trappc11 UTSW 8 47513402 missense probably damaging 0.99
R5176:Trappc11 UTSW 8 47510963 missense possibly damaging 0.79
R5279:Trappc11 UTSW 8 47505304 intron probably benign
R5293:Trappc11 UTSW 8 47493342 missense possibly damaging 0.83
R5294:Trappc11 UTSW 8 47530731 missense possibly damaging 0.88
R5661:Trappc11 UTSW 8 47512607 missense probably damaging 0.99
R5838:Trappc11 UTSW 8 47512559 critical splice donor site probably null
R5889:Trappc11 UTSW 8 47519578 missense probably benign 0.40
R5952:Trappc11 UTSW 8 47496917 critical splice donor site probably null
R5959:Trappc11 UTSW 8 47501558 missense probably damaging 0.97
R6239:Trappc11 UTSW 8 47529494 missense possibly damaging 0.73
R6322:Trappc11 UTSW 8 47530773 missense possibly damaging 0.95
R6369:Trappc11 UTSW 8 47512285 splice site probably null
R7541:Trappc11 UTSW 8 47505582 splice site probably null
R7544:Trappc11 UTSW 8 47522414 missense possibly damaging 0.73
R7762:Trappc11 UTSW 8 47522376 missense probably damaging 0.99
R8183:Trappc11 UTSW 8 47529356 missense possibly damaging 0.93
R8282:Trappc11 UTSW 8 47516589 missense probably damaging 0.97
R8733:Trappc11 UTSW 8 47501848 missense probably damaging 1.00
R8782:Trappc11 UTSW 8 47498666 missense probably benign 0.44
R8853:Trappc11 UTSW 8 47529404 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCAGTGTTAGAAGATCCTCAC -3'
(R):5'- GGGTGACAGACTTAGAACTTTATTC -3'

Sequencing Primer
(F):5'- CCTTGCTAATGTAGACCAGGCTAG -3'
(R):5'- GAACTTTATTCCTGATGACAAACTTG -3'
Posted On2020-09-15