Incidental Mutation 'R2323:Hmox2'
ID244819
Institutional Source Beutler Lab
Gene Symbol Hmox2
Ensembl Gene ENSMUSG00000004070
Gene Nameheme oxygenase 2
SynonymsHO2, HO-2
MMRRC Submission 040314-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2323 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location4726361-4766742 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 4765856 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 263 (K263*)
Ref Sequence ENSEMBL: ENSMUSP00000112397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004172] [ENSMUST00000004173] [ENSMUST00000117713] [ENSMUST00000118703] [ENSMUST00000118885] [ENSMUST00000120232] [ENSMUST00000121529] [ENSMUST00000140367] [ENSMUST00000147225] [ENSMUST00000154117]
Predicted Effect probably null
Transcript: ENSMUST00000004172
AA Change: K263*
SMART Domains Protein: ENSMUSP00000004172
Gene: ENSMUSG00000004070
AA Change: K263*

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 30 235 2e-83 PFAM
transmembrane domain 295 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000004173
SMART Domains Protein: ENSMUSP00000004173
Gene: ENSMUSG00000004071

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
low complexity region 77 110 N/A INTRINSIC
LITAF 137 206 4.1e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117713
SMART Domains Protein: ENSMUSP00000113618
Gene: ENSMUSG00000004071

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
low complexity region 81 93 N/A INTRINSIC
LITAF 120 189 4.1e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118703
SMART Domains Protein: ENSMUSP00000113889
Gene: ENSMUSG00000004071

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
low complexity region 77 110 N/A INTRINSIC
LITAF 137 206 4.1e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118885
AA Change: K263*
SMART Domains Protein: ENSMUSP00000113110
Gene: ENSMUSG00000004070
AA Change: K263*

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 30 235 2e-83 PFAM
transmembrane domain 295 314 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120232
AA Change: K263*
SMART Domains Protein: ENSMUSP00000112397
Gene: ENSMUSG00000004070
AA Change: K263*

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 30 235 2e-83 PFAM
transmembrane domain 295 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121529
SMART Domains Protein: ENSMUSP00000112378
Gene: ENSMUSG00000004070

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 30 228 6.8e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140187
Predicted Effect probably benign
Transcript: ENSMUST00000140367
SMART Domains Protein: ENSMUSP00000115932
Gene: ENSMUSG00000004070

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 30 93 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147225
SMART Domains Protein: ENSMUSP00000120143
Gene: ENSMUSG00000004071

DomainStartEndE-ValueType
low complexity region 41 59 N/A INTRINSIC
low complexity region 67 100 N/A INTRINSIC
Pfam:zf-LITAF-like 123 163 3.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152667
Predicted Effect probably benign
Transcript: ENSMUST00000154117
SMART Domains Protein: ENSMUSP00000122699
Gene: ENSMUSG00000004070

DomainStartEndE-ValueType
Pfam:Heme_oxygenase 1 65 1.9e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene are normal for the most part. However, they are sensitive to incrreases and decreases in oxygen levels and this results in some behavioral and nervous system response abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T A 5: 90,584,852 Y507* probably null Het
Abca2 G T 2: 25,445,175 M2008I probably benign Het
Adgrv1 A G 13: 81,595,179 S68P probably damaging Het
Anks3 T C 16: 4,950,770 probably null Het
Asap2 T C 12: 21,203,968 I160T probably damaging Het
Asb15 T A 6: 24,556,601 F32I probably benign Het
Catip A T 1: 74,363,278 M103L probably benign Het
Cela2a G C 4: 141,826,079 probably benign Het
Crebrf T C 17: 26,763,607 probably benign Het
Dnah10 T C 5: 124,742,000 M450T probably damaging Het
Dst T C 1: 34,228,437 S5165P possibly damaging Het
Esrp2 T A 8: 106,134,302 D196V probably benign Het
Ints10 A G 8: 68,819,345 H566R probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Liph A G 16: 21,984,004 V105A probably damaging Het
Myo1e T A 9: 70,378,758 Y941* probably null Het
Myo7b T C 18: 31,971,345 E1450G probably damaging Het
Myt1 G T 2: 181,806,557 A594S probably damaging Het
Npas3 T A 12: 54,068,346 Y666N probably damaging Het
Npsr1 A G 9: 24,300,436 K240E probably damaging Het
Olfr652 T C 7: 104,564,619 F133L probably benign Het
Rtkn2 A G 10: 68,001,934 I102M probably damaging Het
Rundc1 T C 11: 101,425,275 F58L probably damaging Het
Snrpc T G 17: 27,847,974 M91R unknown Het
Tgfbr2 T C 9: 116,110,144 K205R possibly damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tnfrsf21 C A 17: 43,085,529 S568* probably null Het
Tulp1 C T 17: 28,362,482 G239D probably damaging Het
Vmn1r234 T C 17: 21,229,703 I293T probably benign Het
Vmn1r26 T C 6: 58,008,857 K116E probably damaging Het
Vmn2r98 T A 17: 19,065,819 I193K probably benign Het
Wnk4 T A 11: 101,268,481 S575T probably damaging Het
Zfp558 A T 9: 18,469,277 probably null Het
Zscan18 T C 7: 12,775,459 probably benign Het
Other mutations in Hmox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4453001:Hmox2 UTSW 16 4765057 missense probably damaging 1.00
R0014:Hmox2 UTSW 16 4765033 missense probably damaging 0.99
R0014:Hmox2 UTSW 16 4765033 missense probably damaging 0.99
R0396:Hmox2 UTSW 16 4765763 missense probably benign 0.02
R5913:Hmox2 UTSW 16 4764868 missense probably damaging 1.00
Z1177:Hmox2 UTSW 16 4757128 intron probably benign
Predicted Primers PCR Primer
(F):5'- CTCCATGGGTCATCTGTAGAGTG -3'
(R):5'- CAAGAGTCCAGCTACCAAGG -3'

Sequencing Primer
(F):5'- ATGGGTCATCTGTAGAGTGTAAATTC -3'
(R):5'- TGCAGGCTAGGCTTCCTCAG -3'
Posted On2014-10-30