Incidental Mutation 'R2314:Pou3f3'
ID245392
Institutional Source Beutler Lab
Gene Symbol Pou3f3
Ensembl Gene ENSMUSG00000045515
Gene NamePOU domain, class 3, transcription factor 3
SynonymsOtf8, Brn1, Brn-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location42695768-42703176 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42698491 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 449 (V449A)
Ref Sequence ENSEMBL: ENSMUSP00000052088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054883]
Predicted Effect probably damaging
Transcript: ENSMUST00000054883
AA Change: V449A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052088
Gene: ENSMUSG00000045515
AA Change: V449A

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
low complexity region 132 146 N/A INTRINSIC
low complexity region 162 206 N/A INTRINSIC
low complexity region 212 224 N/A INTRINSIC
low complexity region 235 250 N/A INTRINSIC
low complexity region 269 301 N/A INTRINSIC
POU 311 385 9.06e-54 SMART
HOX 403 465 3.91e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199521
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a POU-domain containing protein that functions as a transcription factor. The encoded protein recognizes an octamer sequence in the DNA of target genes. This protein may play a role in development of the nervous system. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in death within 36 hours after birth. Mutant brains exhibit disorganized cells in the hippocampus and adjacent transitional cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Onecut2 G T 18: 64,341,197 R254L probably damaging Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Pou3f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Pou3f3 APN 1 42698526 missense probably benign 0.05
R0800:Pou3f3 UTSW 1 42698367 missense probably damaging 1.00
R4391:Pou3f3 UTSW 1 42697458 missense unknown
R4529:Pou3f3 UTSW 1 42698554 missense probably benign 0.15
R5233:Pou3f3 UTSW 1 42698278 missense probably benign 0.17
R6536:Pou3f3 UTSW 1 42698214 missense probably damaging 1.00
R7750:Pou3f3 UTSW 1 42698148 missense probably damaging 1.00
R7936:Pou3f3 UTSW 1 42697400 missense unknown
Predicted Primers PCR Primer
(F):5'- CATTGACAAGATCGCAGCGC -3'
(R):5'- AAGAGTCTCATCGGTCTCCAG -3'

Sequencing Primer
(F):5'- TCCTCAAGTGCCCTAAAC -3'
(R):5'- CGTGGCACGCCTGTCTTTG -3'
Posted On2014-10-30