Incidental Mutation 'R2314:Onecut2'
ID245445
Institutional Source Beutler Lab
Gene Symbol Onecut2
Ensembl Gene ENSMUSG00000045991
Gene Nameone cut domain, family member 2
SynonymsOc2, OC-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock #R2314 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location64340364-64398488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 64341197 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 254 (R254L)
Ref Sequence ENSEMBL: ENSMUSP00000135692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115145] [ENSMUST00000175965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115145
AA Change: R273L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110798
Gene: ENSMUSG00000045991
AA Change: R273L

DomainStartEndE-ValueType
low complexity region 34 56 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 146 158 N/A INTRINSIC
low complexity region 167 185 N/A INTRINSIC
low complexity region 311 323 N/A INTRINSIC
CUT 326 411 1e-42 SMART
HOX 427 489 2.63e-12 SMART
low complexity region 491 501 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175965
AA Change: R254L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135692
Gene: ENSMUSG00000045991
AA Change: R254L

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 73 92 N/A INTRINSIC
low complexity region 127 139 N/A INTRINSIC
low complexity region 148 166 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
CUT 307 392 1e-42 SMART
HOX 408 470 2.63e-12 SMART
low complexity region 472 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the onecut family of transcription factors, which are characterized by a cut domain and an atypical homeodomain. The protein binds to specific DNA sequences and stimulates expression of target genes, including genes involved in melanocyte and hepatocyte differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in abnormal bile duct development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,684,702 S466G probably benign Het
Aasdhppt A G 9: 4,309,322 S39P probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anxa6 T A 11: 55,011,735 I58F probably damaging Het
Ccdc30 T A 4: 119,324,566 K582* probably null Het
Cebpz A G 17: 78,920,547 probably null Het
Clstn3 T A 6: 124,450,717 D473V probably benign Het
Cry1 A T 10: 85,133,311 C550S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dolk G T 2: 30,285,485 L183M probably damaging Het
Dpys T C 15: 39,828,090 T279A possibly damaging Het
Drd4 T C 7: 141,293,941 Y140H probably damaging Het
Duox1 C A 2: 122,333,730 C890* probably null Het
Epha2 T A 4: 141,319,014 V508E probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fahd1 A T 17: 24,849,596 I169N probably damaging Het
Fgfr1 C T 8: 25,570,893 S527F probably damaging Het
Flywch1 A G 17: 23,763,026 V68A probably benign Het
Gm21834 A T 17: 57,742,215 V2E possibly damaging Het
Gm7853 A T 14: 36,089,664 noncoding transcript Het
Igf2r T A 17: 12,715,943 H713L probably benign Het
Iqgap3 T C 3: 88,116,031 V543A probably benign Het
Kcnq5 T A 1: 21,479,371 probably null Het
Lsm1 C T 8: 25,785,684 P5S possibly damaging Het
March1 T C 8: 66,121,790 M1T probably null Het
Myocd T C 11: 65,200,807 H103R probably damaging Het
Myom2 C T 8: 15,063,927 T25I probably damaging Het
Nck1 T C 9: 100,497,950 K83E probably damaging Het
Nid2 A G 14: 19,789,761 D806G probably benign Het
Olfr639 T A 7: 104,012,229 M158L probably benign Het
Plxna1 A C 6: 89,324,316 L1534R probably damaging Het
Polb C A 8: 22,640,002 A185S possibly damaging Het
Pou3f3 T C 1: 42,698,491 V449A probably damaging Het
Pskh1 C T 8: 105,913,513 T275I probably damaging Het
Rab18 C A 18: 6,788,516 A161D probably damaging Het
Rrp8 T C 7: 105,734,804 R164G probably benign Het
Sacs T A 14: 61,207,759 I2418K probably benign Het
Scrn1 T C 6: 54,525,646 E136G probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slitrk6 C T 14: 110,751,955 A107T probably damaging Het
Tktl2 T A 8: 66,513,143 F451Y probably damaging Het
Tnks1bp1 G A 2: 85,058,915 V529M probably benign Het
Trps1 T C 15: 50,661,346 K874E probably damaging Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Ttn A G 2: 76,766,024 Y20182H probably damaging Het
Ufc1 A T 1: 171,289,248 C116S probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfp809 A G 9: 22,238,680 K158E possibly damaging Het
Zfp81 A G 17: 33,334,623 Y406H probably damaging Het
Other mutations in Onecut2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Onecut2 APN 18 64341089 missense probably damaging 1.00
IGL01712:Onecut2 APN 18 64386602 missense probably damaging 0.97
IGL01925:Onecut2 APN 18 64341514 missense probably damaging 1.00
IGL03105:Onecut2 APN 18 64341508 nonsense probably null
R0197:Onecut2 UTSW 18 64341472 missense possibly damaging 0.91
R0504:Onecut2 UTSW 18 64340749 missense possibly damaging 0.72
R1514:Onecut2 UTSW 18 64341580 missense possibly damaging 0.93
R3923:Onecut2 UTSW 18 64341520 missense probably damaging 0.98
R3924:Onecut2 UTSW 18 64341520 missense probably damaging 0.98
R3925:Onecut2 UTSW 18 64341520 missense probably damaging 0.98
R4888:Onecut2 UTSW 18 64340927 missense possibly damaging 0.86
R5818:Onecut2 UTSW 18 64340975 missense possibly damaging 0.53
R5995:Onecut2 UTSW 18 64341548 missense probably damaging 0.99
R7132:Onecut2 UTSW 18 64340912 missense possibly damaging 0.79
R7232:Onecut2 UTSW 18 64341562 missense probably damaging 1.00
R7250:Onecut2 UTSW 18 64386440 missense probably benign 0.21
R7631:Onecut2 UTSW 18 64340975 missense possibly damaging 0.53
R7887:Onecut2 UTSW 18 64340975 missense possibly damaging 0.53
R7891:Onecut2 UTSW 18 64340975 missense possibly damaging 0.53
R7900:Onecut2 UTSW 18 64341587 missense probably damaging 0.97
R8176:Onecut2 UTSW 18 64340860 missense possibly damaging 0.62
Z1177:Onecut2 UTSW 18 64341307 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGATGCCTAGTATGAGCCAGAG -3'
(R):5'- AACCCTCTGTGCGAAGATCG -3'

Sequencing Primer
(F):5'- TAGTATGAGCCAGAGCCTGTCTC -3'
(R):5'- TGTAGCGCTTCAGCTCG -3'
Posted On2014-10-30