Mutagenetix > Incidental Mutation

Incidental Mutation 'R2401:Clcn7'

248710

Institutional Source

Beutler Lab

Gene Symbol

Clcn7

Ensembl Gene

ENSMUSG00000036636

Gene Name

chloride channel, voltage-sensitive 7

Synonyms

ClC-7

MMRRC Submission

040367-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25133391-25162104 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25153140 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 425 (S425P)

Ref Sequence

ENSEMBL: ENSMUSP00000124194 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000160961]

AlphaFold

O70496

Predicted Effect

probably benign
Transcript: ENSMUST00000040729
AA Change: S445P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: S445P

Domain	Start	End	E-Value	Type
low complexity region	60	74	N/A	INTRINSIC
Pfam:Voltage_CLC	183	594	1.5e-96	PFAM
CBS	632	687	8.38e-4	SMART
CBS	742	790	1.77e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159773

SMART Domains

Protein: ENSMUSP00000125546
Gene: ENSMUSG00000036636

Domain	Start	End	E-Value	Type
Pfam:Voltage_CLC	76	202	5.3e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160961
AA Change: S425P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: S425P

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
low complexity region	40	54	N/A	INTRINSIC
Pfam:Voltage_CLC	163	574	1.5e-93	PFAM
CBS	612	667	8.38e-4	SMART
CBS	722	770	1.77e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161153

Predicted Effect

unknown
Transcript: ENSMUST00000162862
AA Change: S100P

SMART Domains

Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636
AA Change: S100P

Domain	Start	End	E-Value	Type
Pfam:Voltage_CLC	5	307	1.3e-48	PFAM

Meta Mutation Damage Score

0.2442

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,283,089	L1158P	probably damaging	Het
Acnat1	A	T	4: 49,451,077	N11K	possibly damaging	Het
Ammecr1l	T	A	18: 31,776,003	I217N	possibly damaging	Het
Ankrd11	G	A	8: 122,908,734	R54*	probably null	Het
Ccdc178	C	T	18: 22,131,414		probably null	Het
Ccdc36	G	T	9: 108,413,006	T133N	possibly damaging	Het
Cnmd	A	G	14: 79,656,605	V114A	probably damaging	Het
Col13a1	T	C	10: 61,851,162	T651A	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp3a25	T	C	5: 145,986,968		probably null	Het
Dmrta1	A	T	4: 89,691,616	D271V	probably benign	Het
Efcab3	T	A	11: 105,072,318		probably null	Het
Exo5	T	C	4: 120,921,997	I224V	probably damaging	Het
Fam162b	C	A	10: 51,587,218	A118S	probably damaging	Het
Glb1	A	G	9: 114,454,257	T406A	possibly damaging	Het
Grk3	T	C	5: 112,914,983	N666S	probably benign	Het
Hars2	T	C	18: 36,789,523	F370L	possibly damaging	Het
Ighv8-11	T	G	12: 115,567,603		probably benign	Het
Inpp4b	A	T	8: 81,997,339	D500V	probably benign	Het
Itgb4	A	G	11: 116,006,563	D1534G	possibly damaging	Het
Kcnk2	G	C	1: 189,340,017	T38S	possibly damaging	Het
Kif16b	C	T	2: 142,756,122	V527I	probably benign	Het
Kmt2b	A	G	7: 30,576,708	Y1789H	probably damaging	Het
Lpl	A	C	8: 68,901,243	D412A	possibly damaging	Het
Lrrc27	T	G	7: 139,223,613	L151R	probably damaging	Het
Muc3	T	C	5: 137,154,041		probably benign	Het
Nup205	T	A	6: 35,208,134	Y829*	probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfm4	A	G	14: 80,021,752	Y447C	probably damaging	Het
Olfr1308	T	C	2: 111,960,149	Y308C	probably benign	Het
Pcdhb6	T	C	18: 37,335,169	V381A	probably benign	Het
Prmt2	C	T	10: 76,225,415	W79*	probably null	Het
Skiv2l	T	C	17: 34,840,385	M1029V	probably benign	Het
Stil	A	G	4: 115,016,286	R369G	probably null	Het
Ttc41	T	C	10: 86,724,374	I387T	probably benign	Het
Tubgcp6	A	G	15: 89,102,984	L1262P	probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zfp804b	T	C	5: 6,769,445	H1206R	probably damaging	Het

Other mutations in Clcn7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Clcn7	APN	17	25151123	missense	probably damaging	1.00
IGL01735:Clcn7	APN	17	25151116	missense	probably benign	0.13
IGL01912:Clcn7	APN	17	25153009	splice site	probably benign
IGL01936:Clcn7	APN	17	25155376	missense	probably benign	0.44
IGL02084:Clcn7	APN	17	25157925	missense	probably benign
IGL02121:Clcn7	APN	17	25153084	missense	possibly damaging	0.95
IGL02160:Clcn7	APN	17	25149030	unclassified	probably benign
IGL02335:Clcn7	APN	17	25146847	missense	probably benign	0.00
IGL02507:Clcn7	APN	17	25144469	missense	probably damaging	1.00
IGL02605:Clcn7	APN	17	25146818	missense	possibly damaging	0.60
IGL03160:Clcn7	APN	17	25146453	unclassified	probably benign
IGL03192:Clcn7	APN	17	25133601	missense	probably benign	0.00
IGL03194:Clcn7	APN	17	25150548	missense	probably damaging	0.98
IGL03409:Clcn7	APN	17	25155385	missense	probably damaging	1.00
R0140:Clcn7	UTSW	17	25153754	missense	probably damaging	1.00
R0153:Clcn7	UTSW	17	25149202	unclassified	probably benign
R0970:Clcn7	UTSW	17	25151234	critical splice donor site	probably null
R1644:Clcn7	UTSW	17	25159698	missense	probably damaging	1.00
R1856:Clcn7	UTSW	17	25160471	missense	probably damaging	1.00
R2145:Clcn7	UTSW	17	25144451	missense	probably benign
R2173:Clcn7	UTSW	17	25145609	missense	probably benign
R2511:Clcn7	UTSW	17	25155446	missense	probably damaging	1.00
R3683:Clcn7	UTSW	17	25150593	missense	possibly damaging	0.84
R3684:Clcn7	UTSW	17	25150593	missense	possibly damaging	0.84
R3694:Clcn7	UTSW	17	25159707	missense	probably damaging	0.99
R4424:Clcn7	UTSW	17	25160176	missense	probably damaging	1.00
R4681:Clcn7	UTSW	17	25157961	missense	probably damaging	1.00
R4870:Clcn7	UTSW	17	25153565	intron	probably benign
R5372:Clcn7	UTSW	17	25157179	missense	possibly damaging	0.82
R5820:Clcn7	UTSW	17	25149052	missense	probably damaging	1.00
R6154:Clcn7	UTSW	17	25157954	missense	probably damaging	0.98
R6181:Clcn7	UTSW	17	25151728	missense	possibly damaging	0.79
R6306:Clcn7	UTSW	17	25157528	missense	probably benign	0.01
R6798:Clcn7	UTSW	17	25159760	missense	probably damaging	1.00
R6961:Clcn7	UTSW	17	25157214	missense	probably damaging	1.00
R7020:Clcn7	UTSW	17	25146351	missense	possibly damaging	0.76
R7089:Clcn7	UTSW	17	25153693	missense
R7757:Clcn7	UTSW	17	25156822	missense	probably damaging	1.00
R8057:Clcn7	UTSW	17	25149259	nonsense	probably null
R8670:Clcn7	UTSW	17	25159614	missense	probably damaging	0.99
R9031:Clcn7	UTSW	17	25157523	missense	probably damaging	0.96
R9720:Clcn7	UTSW	17	25155497	missense	probably damaging	1.00
X0020:Clcn7	UTSW	17	25150226	missense	probably damaging	1.00
Z1177:Clcn7	UTSW	17	25153015	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCATCAATGGGTTCTGGGTC -3'
(R):5'- TTTGGTGAGATCACTCTAGTACCC -3'

Sequencing Primer
(F):5'- GCAGATGAGGCTACTGTCC -3'
(R):5'- GTGAGATCACTCTAGTACCCACTCC -3'

Posted On

2014-11-11