Mutagenetix > Incidental Mutation

Incidental Mutation 'R2401:Vmn2r112'

248709

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r112

Ensembl Gene

ENSMUSG00000094921

Gene Name

vomeronasal 2, receptor 112

Synonyms

EG628185

MMRRC Submission

040367-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R2401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22601148-22619133 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22603115 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 258 (V258E)

Ref Sequence

ENSEMBL: ENSMUSP00000094994 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097381]

AlphaFold

L7N221

Predicted Effect

probably damaging
Transcript: ENSMUST00000097381
AA Change: V258E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000094994
Gene: ENSMUSG00000094921
AA Change: V258E

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.8e-32	PFAM
Pfam:NCD3G	512	565	5.8e-21	PFAM
Pfam:7tm_3	598	833	6.5e-54	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (40/40)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,283,089	L1158P	probably damaging	Het
Acnat1	A	T	4: 49,451,077	N11K	possibly damaging	Het
Ammecr1l	T	A	18: 31,776,003	I217N	possibly damaging	Het
Ankrd11	G	A	8: 122,908,734	R54*	probably null	Het
Ccdc178	C	T	18: 22,131,414		probably null	Het
Ccdc36	G	T	9: 108,413,006	T133N	possibly damaging	Het
Clcn7	T	C	17: 25,153,140	S425P	probably benign	Het
Cnmd	A	G	14: 79,656,605	V114A	probably damaging	Het
Col13a1	T	C	10: 61,851,162	T651A	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp3a25	T	C	5: 145,986,968		probably null	Het
Dmrta1	A	T	4: 89,691,616	D271V	probably benign	Het
Efcab3	T	A	11: 105,072,318		probably null	Het
Exo5	T	C	4: 120,921,997	I224V	probably damaging	Het
Fam162b	C	A	10: 51,587,218	A118S	probably damaging	Het
Glb1	A	G	9: 114,454,257	T406A	possibly damaging	Het
Grk3	T	C	5: 112,914,983	N666S	probably benign	Het
Hars2	T	C	18: 36,789,523	F370L	possibly damaging	Het
Ighv8-11	T	G	12: 115,567,603		probably benign	Het
Inpp4b	A	T	8: 81,997,339	D500V	probably benign	Het
Itgb4	A	G	11: 116,006,563	D1534G	possibly damaging	Het
Kcnk2	G	C	1: 189,340,017	T38S	possibly damaging	Het
Kif16b	C	T	2: 142,756,122	V527I	probably benign	Het
Kmt2b	A	G	7: 30,576,708	Y1789H	probably damaging	Het
Lpl	A	C	8: 68,901,243	D412A	possibly damaging	Het
Lrrc27	T	G	7: 139,223,613	L151R	probably damaging	Het
Muc3	T	C	5: 137,154,041		probably benign	Het
Nup205	T	A	6: 35,208,134	Y829*	probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfm4	A	G	14: 80,021,752	Y447C	probably damaging	Het
Olfr1308	T	C	2: 111,960,149	Y308C	probably benign	Het
Pcdhb6	T	C	18: 37,335,169	V381A	probably benign	Het
Prmt2	C	T	10: 76,225,415	W79*	probably null	Het
Skiv2l	T	C	17: 34,840,385	M1029V	probably benign	Het
Stil	A	G	4: 115,016,286	R369G	probably null	Het
Ttc41	T	C	10: 86,724,374	I387T	probably benign	Het
Tubgcp6	A	G	15: 89,102,984	L1262P	probably benign	Het
Zfp804b	T	C	5: 6,769,445	H1206R	probably damaging	Het

Other mutations in Vmn2r112

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Vmn2r112	APN	17	22618936	missense	probably benign	0.13
IGL01021:Vmn2r112	APN	17	22618904	missense	probably damaging	1.00
IGL01122:Vmn2r112	APN	17	22603007	missense	probably benign	0.00
IGL01360:Vmn2r112	APN	17	22618622	missense	probably benign	0.03
IGL01536:Vmn2r112	APN	17	22605155	missense	probably damaging	1.00
IGL02148:Vmn2r112	APN	17	22619032	missense	probably damaging	1.00
IGL02465:Vmn2r112	APN	17	22614994	missense	probably damaging	1.00
PIT4576001:Vmn2r112	UTSW	17	22614931	missense	probably benign	0.00
R0278:Vmn2r112	UTSW	17	22603006	missense	probably benign	0.44
R0328:Vmn2r112	UTSW	17	22605270	missense	probably benign	0.01
R0583:Vmn2r112	UTSW	17	22618949	missense	probably damaging	1.00
R0831:Vmn2r112	UTSW	17	22614999	missense	probably damaging	0.99
R1080:Vmn2r112	UTSW	17	22618999	missense	probably damaging	1.00
R1245:Vmn2r112	UTSW	17	22603247	missense	probably benign	0.03
R1321:Vmn2r112	UTSW	17	22618519	nonsense	probably null
R1381:Vmn2r112	UTSW	17	22618486	missense	probably damaging	1.00
R1514:Vmn2r112	UTSW	17	22602844	missense	probably benign	0.40
R1519:Vmn2r112	UTSW	17	22618903	missense	possibly damaging	0.83
R1572:Vmn2r112	UTSW	17	22603144	missense	possibly damaging	0.61
R1590:Vmn2r112	UTSW	17	22615008	critical splice donor site	probably null
R1640:Vmn2r112	UTSW	17	22605116	missense	probably benign	0.01
R2221:Vmn2r112	UTSW	17	22601233	missense	possibly damaging	0.86
R2223:Vmn2r112	UTSW	17	22601233	missense	possibly damaging	0.86
R2310:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2312:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2337:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2339:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2340:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2341:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2342:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2860:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2861:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R2926:Vmn2r112	UTSW	17	22615003	missense	possibly damaging	0.90
R3236:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R3237:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R3977:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R3979:Vmn2r112	UTSW	17	22603115	missense	probably damaging	0.98
R4168:Vmn2r112	UTSW	17	22603088	missense	probably benign	0.01
R4256:Vmn2r112	UTSW	17	22618412	missense	probably damaging	1.00
R4386:Vmn2r112	UTSW	17	22601322	missense	probably benign	0.36
R4912:Vmn2r112	UTSW	17	22603382	missense	probably damaging	0.99
R4947:Vmn2r112	UTSW	17	22602879	missense	probably benign	0.02
R5446:Vmn2r112	UTSW	17	22618250	missense	probably damaging	1.00
R5870:Vmn2r112	UTSW	17	22619023	missense	probably benign	0.00
R6351:Vmn2r112	UTSW	17	22601278	missense	probably benign
R6384:Vmn2r112	UTSW	17	22605155	missense	probably damaging	1.00
R6390:Vmn2r112	UTSW	17	22605249	missense	probably benign	0.01
R6401:Vmn2r112	UTSW	17	22603551	nonsense	probably null
R6405:Vmn2r112	UTSW	17	22618235	missense	probably damaging	1.00
R6620:Vmn2r112	UTSW	17	22603101	missense	probably benign	0.00
R6648:Vmn2r112	UTSW	17	22618486	missense	probably damaging	1.00
R6649:Vmn2r112	UTSW	17	22601179	missense	probably null	1.00
R6653:Vmn2r112	UTSW	17	22601179	missense	probably null	1.00
R6654:Vmn2r112	UTSW	17	22603469	missense	possibly damaging	0.89
R6700:Vmn2r112	UTSW	17	22603481	missense	possibly damaging	0.53
R6993:Vmn2r112	UTSW	17	22603214	missense	probably benign	0.01
R7052:Vmn2r112	UTSW	17	22602526	missense	probably benign
R7454:Vmn2r112	UTSW	17	22603307	missense	probably benign	0.00
R7763:Vmn2r112	UTSW	17	22603118	missense	probably damaging	1.00
R8032:Vmn2r112	UTSW	17	22603394	missense	probably benign	0.21
R8177:Vmn2r112	UTSW	17	22603613	missense	possibly damaging	0.47
R8263:Vmn2r112	UTSW	17	22605159	missense	probably damaging	1.00
R8395:Vmn2r112	UTSW	17	22618606	missense	possibly damaging	0.94
R8492:Vmn2r112	UTSW	17	22602489	missense	probably benign	0.03
R8889:Vmn2r112	UTSW	17	22618631	missense	probably damaging	1.00
R8892:Vmn2r112	UTSW	17	22618631	missense	probably damaging	1.00
R9246:Vmn2r112	UTSW	17	22605107	missense	probably benign	0.21
R9269:Vmn2r112	UTSW	17	22601232	missense	probably benign
R9273:Vmn2r112	UTSW	17	22618740	missense	probably damaging	1.00
R9288:Vmn2r112	UTSW	17	22603342	missense	probably damaging	1.00
R9352:Vmn2r112	UTSW	17	22603498	missense	probably damaging	0.98
R9406:Vmn2r112	UTSW	17	22605242	nonsense	probably null
R9432:Vmn2r112	UTSW	17	22602252	missense
R9728:Vmn2r112	UTSW	17	22605127	missense	probably damaging	0.96
Z1088:Vmn2r112	UTSW	17	22605078	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GGCCTCTGATCATACATCTCTAGC -3'
(R):5'- TTGACTGAGTTCAATGTCTGCAC -3'

Sequencing Primer
(F):5'- GATCATACATCTCTAGCCCTTGC -3'
(R):5'- CCAGAAATCTCACTATTGTGTTGTTG -3'

Posted On

2014-11-11