Mutagenetix > Incidental Mutation

Incidental Mutation 'R2401:Tubgcp6'

248707

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp6

Ensembl Gene

ENSMUSG00000051786

Gene Name

tubulin, gamma complex associated protein 6

Synonyms

MMRRC Submission

040367-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R2401 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89098357-89123112 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89102984 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1262 (L1262P)

Ref Sequence

ENSEMBL: ENSMUSP00000104977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082439] [ENSMUST00000109353] [ENSMUST00000130700] [ENSMUST00000166480]

AlphaFold

G5E8P0

Predicted Effect

probably benign
Transcript: ENSMUST00000041656
AA Change: L1254P

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786
AA Change: L1254P

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	355	1667	3.3e-119	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000082439

SMART Domains

Protein: ENSMUSP00000081020
Gene: ENSMUSG00000035757

Domain	Start	End	E-Value	Type
low complexity region	24	38	N/A	INTRINSIC
Pfam:UPF0061	79	625	8.3e-131	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109353
AA Change: L1262P

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786
AA Change: L1262P

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	355	1675	2.8e-94	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130700

SMART Domains

Protein: ENSMUSP00000138382
Gene: ENSMUSG00000035757

Domain	Start	End	E-Value	Type
low complexity region	24	38	N/A	INTRINSIC
Pfam:UPF0061	80	241	1.5e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163290

SMART Domains

Protein: ENSMUSP00000131359
Gene: ENSMUSG00000051786

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	91	288	2.9e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164717

Predicted Effect

probably benign
Transcript: ENSMUST00000166480

SMART Domains

Protein: ENSMUSP00000132108
Gene: ENSMUSG00000051786

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	2	123	5e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168256

Predicted Effect

probably benign
Transcript: ENSMUST00000169069

SMART Domains

Protein: ENSMUSP00000132786
Gene: ENSMUSG00000051786

Domain	Start	End	E-Value	Type
coiled coil region	77	107	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169208

Predicted Effect

probably benign
Transcript: ENSMUST00000170877

Meta Mutation Damage Score

0.1092

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	C	7: 120,283,089	L1158P	probably damaging	Het
Acnat1	A	T	4: 49,451,077	N11K	possibly damaging	Het
Ammecr1l	T	A	18: 31,776,003	I217N	possibly damaging	Het
Ankrd11	G	A	8: 122,908,734	R54*	probably null	Het
Ccdc178	C	T	18: 22,131,414		probably null	Het
Ccdc36	G	T	9: 108,413,006	T133N	possibly damaging	Het
Clcn7	T	C	17: 25,153,140	S425P	probably benign	Het
Cnmd	A	G	14: 79,656,605	V114A	probably damaging	Het
Col13a1	T	C	10: 61,851,162	T651A	unknown	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyp3a25	T	C	5: 145,986,968		probably null	Het
Dmrta1	A	T	4: 89,691,616	D271V	probably benign	Het
Efcab3	T	A	11: 105,072,318		probably null	Het
Exo5	T	C	4: 120,921,997	I224V	probably damaging	Het
Fam162b	C	A	10: 51,587,218	A118S	probably damaging	Het
Glb1	A	G	9: 114,454,257	T406A	possibly damaging	Het
Grk3	T	C	5: 112,914,983	N666S	probably benign	Het
Hars2	T	C	18: 36,789,523	F370L	possibly damaging	Het
Ighv8-11	T	G	12: 115,567,603		probably benign	Het
Inpp4b	A	T	8: 81,997,339	D500V	probably benign	Het
Itgb4	A	G	11: 116,006,563	D1534G	possibly damaging	Het
Kcnk2	G	C	1: 189,340,017	T38S	possibly damaging	Het
Kif16b	C	T	2: 142,756,122	V527I	probably benign	Het
Kmt2b	A	G	7: 30,576,708	Y1789H	probably damaging	Het
Lpl	A	C	8: 68,901,243	D412A	possibly damaging	Het
Lrrc27	T	G	7: 139,223,613	L151R	probably damaging	Het
Muc3	T	C	5: 137,154,041		probably benign	Het
Nup205	T	A	6: 35,208,134	Y829*	probably null	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfm4	A	G	14: 80,021,752	Y447C	probably damaging	Het
Olfr1308	T	C	2: 111,960,149	Y308C	probably benign	Het
Pcdhb6	T	C	18: 37,335,169	V381A	probably benign	Het
Prmt2	C	T	10: 76,225,415	W79*	probably null	Het
Skiv2l	T	C	17: 34,840,385	M1029V	probably benign	Het
Stil	A	G	4: 115,016,286	R369G	probably null	Het
Ttc41	T	C	10: 86,724,374	I387T	probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zfp804b	T	C	5: 6,769,445	H1206R	probably damaging	Het

Other mutations in Tubgcp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Tubgcp6	APN	15	89104008	missense	probably benign	0.00
IGL00556:Tubgcp6	APN	15	89100962	missense	probably damaging	1.00
IGL00943:Tubgcp6	APN	15	89122397	nonsense	probably null
IGL01284:Tubgcp6	APN	15	89110055	missense	probably damaging	1.00
IGL01363:Tubgcp6	APN	15	89107525	missense	probably damaging	1.00
IGL01386:Tubgcp6	APN	15	89107996	nonsense	probably null
IGL01792:Tubgcp6	APN	15	89101281	missense	probably damaging	1.00
IGL01866:Tubgcp6	APN	15	89103488	missense	probably benign	0.01
IGL02596:Tubgcp6	APN	15	89100914	missense	probably damaging	1.00
IGL02858:Tubgcp6	APN	15	89102315	nonsense	probably null
IGL02873:Tubgcp6	APN	15	89103824	missense	probably benign	0.00
IGL03400:Tubgcp6	APN	15	89108099	unclassified	probably benign
IGL02796:Tubgcp6	UTSW	15	89122390	missense	probably benign	0.03
R0010:Tubgcp6	UTSW	15	89103183	missense	probably benign	0.00
R0308:Tubgcp6	UTSW	15	89122436	missense	possibly damaging	0.85
R0440:Tubgcp6	UTSW	15	89103065	missense	probably benign	0.12
R0631:Tubgcp6	UTSW	15	89100987	missense	probably damaging	1.00
R1653:Tubgcp6	UTSW	15	89107442	missense	probably damaging	1.00
R1901:Tubgcp6	UTSW	15	89116241	missense	possibly damaging	0.68
R1902:Tubgcp6	UTSW	15	89116241	missense	possibly damaging	0.68
R1905:Tubgcp6	UTSW	15	89100608	missense	probably damaging	1.00
R2005:Tubgcp6	UTSW	15	89104166	missense	probably benign	0.01
R2067:Tubgcp6	UTSW	15	89104489	missense	probably benign	0.03
R2083:Tubgcp6	UTSW	15	89122376	missense	probably damaging	1.00
R2285:Tubgcp6	UTSW	15	89122474	missense	probably damaging	1.00
R2436:Tubgcp6	UTSW	15	89102365	missense	probably benign	0.37
R3017:Tubgcp6	UTSW	15	89103082	nonsense	probably null
R3054:Tubgcp6	UTSW	15	89122603	missense	probably damaging	1.00
R3932:Tubgcp6	UTSW	15	89104414	unclassified	probably benign
R4350:Tubgcp6	UTSW	15	89103995	missense	probably benign	0.00
R4472:Tubgcp6	UTSW	15	89103654	missense	probably damaging	0.98
R4864:Tubgcp6	UTSW	15	89103818	missense	probably benign
R4937:Tubgcp6	UTSW	15	89101549	missense	probably damaging	0.98
R4983:Tubgcp6	UTSW	15	89106291	missense	probably damaging	1.00
R4996:Tubgcp6	UTSW	15	89103490	missense	possibly damaging	0.89
R5044:Tubgcp6	UTSW	15	89099545	unclassified	probably benign
R5122:Tubgcp6	UTSW	15	89116103	missense	probably damaging	1.00
R5607:Tubgcp6	UTSW	15	89111150	missense	probably benign	0.02
R5608:Tubgcp6	UTSW	15	89111150	missense	probably benign	0.02
R5653:Tubgcp6	UTSW	15	89108612	missense	possibly damaging	0.47
R5886:Tubgcp6	UTSW	15	89103247	missense	possibly damaging	0.82
R5945:Tubgcp6	UTSW	15	89109217	splice site	probably null
R6111:Tubgcp6	UTSW	15	89100920	missense	possibly damaging	0.83
R6195:Tubgcp6	UTSW	15	89122791	missense	probably benign	0.01
R6792:Tubgcp6	UTSW	15	89122877	start gained	probably benign
R7074:Tubgcp6	UTSW	15	89120636	missense	probably damaging	1.00
R7103:Tubgcp6	UTSW	15	89101029	missense	probably damaging	0.96
R7274:Tubgcp6	UTSW	15	89102970	nonsense	probably null
R7275:Tubgcp6	UTSW	15	89102943	nonsense	probably null
R7514:Tubgcp6	UTSW	15	89120525	missense	probably damaging	1.00
R7540:Tubgcp6	UTSW	15	89102323	missense	possibly damaging	0.48
R7571:Tubgcp6	UTSW	15	89100722	missense	probably damaging	1.00
R7706:Tubgcp6	UTSW	15	89104223	missense	probably benign
R7721:Tubgcp6	UTSW	15	89101401	missense	probably damaging	1.00
R7980:Tubgcp6	UTSW	15	89102029	missense	probably benign	0.03
R7996:Tubgcp6	UTSW	15	89109028	missense	possibly damaging	0.92
R8095:Tubgcp6	UTSW	15	89122774	missense	probably benign	0.07
R8191:Tubgcp6	UTSW	15	89120640	missense	probably damaging	1.00
R8510:Tubgcp6	UTSW	15	89102949	missense	possibly damaging	0.91
R8839:Tubgcp6	UTSW	15	89103478	missense	possibly damaging	0.91
R8862:Tubgcp6	UTSW	15	89122621	missense	probably benign	0.03
R9044:Tubgcp6	UTSW	15	89103194	missense	possibly damaging	0.89
R9321:Tubgcp6	UTSW	15	89107983	missense	probably damaging	1.00
R9402:Tubgcp6	UTSW	15	89102861	missense	probably benign	0.01
R9428:Tubgcp6	UTSW	15	89100897	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTTCCAGAATGCCACAGTCC -3'
(R):5'- AATGTCCACGGGCATGTGTC -3'

Sequencing Primer
(F):5'- TGCCACAGTCCCACCCTG -3'
(R):5'- CATGTGTCAGATGCCAGTATTAG -3'

Posted On

2014-11-11