Incidental Mutation 'R2404:Olfr1369-ps1'
ID 248880
Institutional Source Beutler Lab
Gene Symbol Olfr1369-ps1
Ensembl Gene ENSMUSG00000060404
Gene Name olfactory receptor 1369, pseudogene 1
Synonyms GA_x6K02T2QHY8-12126170-12125935, MOR256-31
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock # R2404 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 21111483-21119095 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 21115842 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 50 (L50P)
Ref Sequence ENSEMBL: ENSMUSP00000151041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079050] [ENSMUST00000213326] [ENSMUST00000213922] [ENSMUST00000215207] [ENSMUST00000215941]
AlphaFold A0A140T8K7
Predicted Effect probably damaging
Transcript: ENSMUST00000079050
AA Change: L50P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078059
Gene: ENSMUSG00000060404
AA Change: L50P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-47 PFAM
Pfam:7tm_1 41 290 1.1e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213326
AA Change: L50P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000213922
AA Change: L50P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215207
AA Change: L50P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215941
AA Change: L50P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Olfr1369-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Olfr1369-ps1 APN 13 21116073 missense probably damaging 0.97
R0631:Olfr1369-ps1 UTSW 13 21115908 missense probably damaging 1.00
R0960:Olfr1369-ps1 UTSW 13 21116265 missense possibly damaging 0.94
R1499:Olfr1369-ps1 UTSW 13 21116133 missense probably benign 0.32
R1549:Olfr1369-ps1 UTSW 13 21116118 missense probably benign 0.01
R1698:Olfr1369-ps1 UTSW 13 21116565 missense probably benign 0.11
R1711:Olfr1369-ps1 UTSW 13 21116306 missense probably benign 0.01
R2471:Olfr1369-ps1 UTSW 13 21116429 missense probably damaging 1.00
R3844:Olfr1369-ps1 UTSW 13 21116063 missense possibly damaging 0.91
R3977:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R3979:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R4804:Olfr1369-ps1 UTSW 13 21116005 nonsense probably null
R4914:Olfr1369-ps1 UTSW 13 21116397 missense probably benign 0.12
R5210:Olfr1369-ps1 UTSW 13 21116052 missense probably damaging 0.99
R5359:Olfr1369-ps1 UTSW 13 21116267 missense probably damaging 1.00
R5700:Olfr1369-ps1 UTSW 13 21116001 missense probably damaging 1.00
R6218:Olfr1369-ps1 UTSW 13 21116231 missense probably damaging 1.00
R6767:Olfr1369-ps1 UTSW 13 21116057 missense probably benign 0.02
R7396:Olfr1369-ps1 UTSW 13 21116307 missense probably benign 0.02
R7476:Olfr1369-ps1 UTSW 13 21116021 missense probably benign 0.04
R7612:Olfr1369-ps1 UTSW 13 21116047 missense probably damaging 0.99
R8257:Olfr1369-ps1 UTSW 13 21116373 missense probably benign 0.11
R9388:Olfr1369-ps1 UTSW 13 21116604 missense probably damaging 0.96
V8831:Olfr1369-ps1 UTSW 13 21116003 missense possibly damaging 0.93
Z1176:Olfr1369-ps1 UTSW 13 21116601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTTACTTCCATAGGCTAAC -3'
(R):5'- AGCAGACACTCAATGGAGCC -3'

Sequencing Primer
(F):5'- CTTGTCACCCTGCCTACTAC -3'
(R):5'- CTCAATGGAGCCCAGCC -3'
Posted On 2014-11-11