Incidental Mutation 'R6767:Olfr1369-ps1'
ID 532003
Institutional Source Beutler Lab
Gene Symbol Olfr1369-ps1
Ensembl Gene ENSMUSG00000060404
Gene Name olfactory receptor 1369, pseudogene 1
Synonyms GA_x6K02T2QHY8-12126170-12125935, MOR256-31
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock # R6767 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 21111483-21119095 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 21116057 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 122 (R122C)
Ref Sequence ENSEMBL: ENSMUSP00000151041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079050] [ENSMUST00000213326] [ENSMUST00000213922] [ENSMUST00000215207] [ENSMUST00000215941]
AlphaFold A0A140T8K7
Predicted Effect probably benign
Transcript: ENSMUST00000079050
AA Change: R122C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000078059
Gene: ENSMUSG00000060404
AA Change: R122C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.2e-47 PFAM
Pfam:7tm_1 41 290 1.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213326
AA Change: R122C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000213922
AA Change: R122C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000215207
AA Change: R122C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000215941
AA Change: R122C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Olfr1369-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Olfr1369-ps1 APN 13 21116073 missense probably damaging 0.97
R0631:Olfr1369-ps1 UTSW 13 21115908 missense probably damaging 1.00
R0960:Olfr1369-ps1 UTSW 13 21116265 missense possibly damaging 0.94
R1499:Olfr1369-ps1 UTSW 13 21116133 missense probably benign 0.32
R1549:Olfr1369-ps1 UTSW 13 21116118 missense probably benign 0.01
R1698:Olfr1369-ps1 UTSW 13 21116565 missense probably benign 0.11
R1711:Olfr1369-ps1 UTSW 13 21116306 missense probably benign 0.01
R2404:Olfr1369-ps1 UTSW 13 21115842 missense probably damaging 1.00
R2471:Olfr1369-ps1 UTSW 13 21116429 missense probably damaging 1.00
R3844:Olfr1369-ps1 UTSW 13 21116063 missense possibly damaging 0.91
R3977:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R3979:Olfr1369-ps1 UTSW 13 21115861 missense probably benign 0.03
R4804:Olfr1369-ps1 UTSW 13 21116005 nonsense probably null
R4914:Olfr1369-ps1 UTSW 13 21116397 missense probably benign 0.12
R5210:Olfr1369-ps1 UTSW 13 21116052 missense probably damaging 0.99
R5359:Olfr1369-ps1 UTSW 13 21116267 missense probably damaging 1.00
R5700:Olfr1369-ps1 UTSW 13 21116001 missense probably damaging 1.00
R6218:Olfr1369-ps1 UTSW 13 21116231 missense probably damaging 1.00
R7396:Olfr1369-ps1 UTSW 13 21116307 missense probably benign 0.02
R7476:Olfr1369-ps1 UTSW 13 21116021 missense probably benign 0.04
R7612:Olfr1369-ps1 UTSW 13 21116047 missense probably damaging 0.99
R8257:Olfr1369-ps1 UTSW 13 21116373 missense probably benign 0.11
R9388:Olfr1369-ps1 UTSW 13 21116604 missense probably damaging 0.96
V8831:Olfr1369-ps1 UTSW 13 21116003 missense possibly damaging 0.93
Z1176:Olfr1369-ps1 UTSW 13 21116601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTAACACTGCTATAATTCTTGC -3'
(R):5'- ATGGCTGGCAACTCACACAG -3'

Sequencing Primer
(F):5'- ATACACCAATGTACTTTTTCCTCAGG -3'
(R):5'- CTGGCAACTCACACAGGAAGTG -3'
Posted On 2018-08-29