Mutagenetix > Incidental Mutation

Incidental Mutation 'R3434:Mast2'

266337

Institutional Source

Beutler Lab

Gene Symbol

Mast2

Ensembl Gene

ENSMUSG00000003810

Gene Name

microtubule associated serine/threonine kinase 2

Synonyms

MAST205, Mtssk

MMRRC Submission

040652-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3434 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116306762-116464183 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 116308095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1314 (S1314T)

Ref Sequence

ENSEMBL: ENSMUSP00000102093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003908] [ENSMUST00000106484] [ENSMUST00000106485] [ENSMUST00000106486]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000003908
AA Change: S1308T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000003908
Gene: ENSMUSG00000003810
AA Change: S1308T

Domain	Start	End	E-Value	Type
low complexity region	38	49	N/A	INTRINSIC
low complexity region	56	63	N/A	INTRINSIC
Pfam:DUF1908	141	416	1.8e-148	PFAM
S_TKc	452	725	2.96e-99	SMART
S_TK_X	726	786	1.08e-1	SMART
low complexity region	849	861	N/A	INTRINSIC
low complexity region	1009	1028	N/A	INTRINSIC
PDZ	1049	1129	2.23e-12	SMART
low complexity region	1142	1157	N/A	INTRINSIC
low complexity region	1177	1210	N/A	INTRINSIC
low complexity region	1224	1249	N/A	INTRINSIC
low complexity region	1279	1302	N/A	INTRINSIC
low complexity region	1345	1360	N/A	INTRINSIC
low complexity region	1437	1452	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106484
AA Change: S1314T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000102093
Gene: ENSMUSG00000003810
AA Change: S1314T

Domain	Start	End	E-Value	Type
low complexity region	38	49	N/A	INTRINSIC
low complexity region	56	63	N/A	INTRINSIC
Pfam:DUF1908	141	423	1.3e-151	PFAM
S_TKc	459	732	2.96e-99	SMART
S_TK_X	733	793	1.08e-1	SMART
low complexity region	856	868	N/A	INTRINSIC
low complexity region	1016	1035	N/A	INTRINSIC
PDZ	1056	1136	2.23e-12	SMART
low complexity region	1149	1164	N/A	INTRINSIC
low complexity region	1184	1217	N/A	INTRINSIC
low complexity region	1233	1255	N/A	INTRINSIC
low complexity region	1285	1308	N/A	INTRINSIC
low complexity region	1351	1366	N/A	INTRINSIC
low complexity region	1443	1458	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106485
AA Change: S1369T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102094
Gene: ENSMUSG00000003810
AA Change: S1369T

Domain	Start	End	E-Value	Type
low complexity region	7	26	N/A	INTRINSIC
low complexity region	27	41	N/A	INTRINSIC
low complexity region	99	110	N/A	INTRINSIC
low complexity region	117	124	N/A	INTRINSIC
Pfam:DUF1908	202	477	1.1e-148	PFAM
S_TKc	513	786	2.96e-99	SMART
S_TK_X	787	847	1.08e-1	SMART
low complexity region	910	922	N/A	INTRINSIC
low complexity region	1070	1089	N/A	INTRINSIC
PDZ	1110	1190	2.23e-12	SMART
low complexity region	1203	1218	N/A	INTRINSIC
low complexity region	1238	1271	N/A	INTRINSIC
low complexity region	1285	1310	N/A	INTRINSIC
low complexity region	1340	1363	N/A	INTRINSIC
low complexity region	1406	1421	N/A	INTRINSIC
low complexity region	1498	1513	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106486
AA Change: S1375T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102095
Gene: ENSMUSG00000003810
AA Change: S1375T

Domain	Start	End	E-Value	Type
low complexity region	7	26	N/A	INTRINSIC
low complexity region	27	41	N/A	INTRINSIC
low complexity region	99	110	N/A	INTRINSIC
low complexity region	117	124	N/A	INTRINSIC
Pfam:DUF1908	202	483	2.9e-143	PFAM
S_TKc	520	793	2.96e-99	SMART
S_TK_X	794	854	1.08e-1	SMART
low complexity region	917	929	N/A	INTRINSIC
low complexity region	1077	1096	N/A	INTRINSIC
PDZ	1117	1197	2.23e-12	SMART
low complexity region	1210	1225	N/A	INTRINSIC
low complexity region	1245	1278	N/A	INTRINSIC
low complexity region	1294	1316	N/A	INTRINSIC
low complexity region	1346	1369	N/A	INTRINSIC
low complexity region	1412	1427	N/A	INTRINSIC
low complexity region	1504	1519	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123761

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128713

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131809

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147459

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156884

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

98% (54/55)

MGI Phenotype

PHENOTYPE: No phenotype has been reported for a gene trap strain; however, it is not yet known whether the gene trap insertion affects expression of the gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	A	17: 24,289,537	A1008V	probably damaging	Het
Adora3	A	G	3: 105,904,915	K39R	probably benign	Het
Ankib1	A	G	5: 3,692,760	V1085A	probably damaging	Het
Atp7a	G	A	X: 106,094,857	R563K	probably benign	Het
Azin1	T	C	15: 38,493,576	I268V	probably benign	Het
Carm1	T	C	9: 21,569,473	F81S	probably damaging	Het
Ccnjl	A	G	11: 43,579,861	Y152C	probably damaging	Het
Chrna3	T	A	9: 55,024,326	I61F	possibly damaging	Het
Clca3a2	G	A	3: 144,808,761		probably benign	Het
Clstn2	T	A	9: 97,454,715	D903V	probably benign	Het
Dpysl3	C	T	18: 43,361,061	V70I	probably benign	Het
Drg2	A	T	11: 60,461,392	K180*	probably null	Het
Dync2h1	A	C	9: 7,011,236	H3659Q	probably benign	Het
Dysf	A	T	6: 84,070,888	Y349F	probably benign	Het
Epb41l4b	T	C	4: 57,040,865	N533D	probably benign	Het
Fam47e	T	A	5: 92,585,362	V152D	probably damaging	Het
Fasn	G	A	11: 120,822,773	A24V	probably damaging	Het
Fhl4	T	C	10: 85,098,444	T158A	probably benign	Het
Fnbp1l	C	T	3: 122,546,306	R499Q	probably damaging	Het
Hdlbp	A	T	1: 93,428,161	M358K	probably benign	Het
Ift74	A	G	4: 94,621,852		probably null	Het
Lhx4	A	G	1: 155,702,401	Y332H	probably damaging	Het
Mast4	A	G	13: 102,787,379	I508T	probably damaging	Het
Mdn1	T	C	4: 32,733,726		probably null	Het
Mrps23	A	G	11: 88,210,114	K44E	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mup6	G	T	4: 60,004,116		probably null	Het
Notch3	A	T	17: 32,158,618	D161E	possibly damaging	Het
Olfr1131	T	C	2: 87,629,074	F204L	probably benign	Het
Olfr1200	T	C	2: 88,768,069	D82G	probably damaging	Het
Olfr695	A	T	7: 106,873,769	Y159N	probably benign	Het
P2rx4	T	A	5: 122,725,070	I202K	probably damaging	Het
Phykpl	A	G	11: 51,598,655	T363A	probably benign	Het
Pitpnm1	G	A	19: 4,112,234	A1047T	probably damaging	Het
Ppat	A	G	5: 76,918,065	I402T	probably damaging	Het
Rpgr	A	G	X: 10,176,602	S656P	probably benign	Het
Rsbn1l	T	C	5: 20,905,930		probably benign	Het
Sacs	A	G	14: 61,212,303	K3933E	probably damaging	Het
Scn7a	T	C	2: 66,675,503	I1681V	probably benign	Het
Sel1l3	T	C	5: 53,117,090	D1016G	probably benign	Het
Sf3a3	C	A	4: 124,725,077	T277N	possibly damaging	Het
Slc35a5	A	G	16: 45,144,033	I279T	probably benign	Het
Slc39a10	T	C	1: 46,835,717	T142A	probably benign	Het
Tle3	T	A	9: 61,414,094		probably null	Het
Tmem117	T	C	15: 95,094,692	I411T	probably damaging	Het
Ttn	T	C	2: 76,868,377	T5A	possibly damaging	Het
Tubgcp3	T	C	8: 12,658,381		probably null	Het
Ush2a	C	T	1: 188,733,758	P2841L	probably damaging	Het
Vmn1r209	A	T	13: 22,806,097	M141K	probably benign	Het
Vmn2r91	A	T	17: 18,110,108		probably benign	Het

Other mutations in Mast2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Mast2	APN	4	116311329	missense	probably benign	0.39
IGL00916:Mast2	APN	4	116327633	missense	possibly damaging	0.88
IGL02112:Mast2	APN	4	116319764	missense	probably damaging	1.00
R0645:Mast2	UTSW	4	116307987	missense	probably damaging	1.00
R0645:Mast2	UTSW	4	116312846	splice site	probably benign
R0883:Mast2	UTSW	4	116311767	missense	probably damaging	1.00
R1447:Mast2	UTSW	4	116312013	missense	probably benign	0.02
R1449:Mast2	UTSW	4	116309013	missense	probably damaging	1.00
R1473:Mast2	UTSW	4	116311955	missense	probably damaging	1.00
R1491:Mast2	UTSW	4	116316491	missense	possibly damaging	0.90
R1529:Mast2	UTSW	4	116430519	missense	probably benign	0.17
R1654:Mast2	UTSW	4	116316550	critical splice acceptor site	probably null
R1768:Mast2	UTSW	4	116306959	missense	probably damaging	1.00
R1807:Mast2	UTSW	4	116310741	splice site	probably benign
R1981:Mast2	UTSW	4	116314840	missense	probably damaging	1.00
R2081:Mast2	UTSW	4	116330474	splice site	probably null
R2157:Mast2	UTSW	4	116322283	missense	probably damaging	1.00
R3409:Mast2	UTSW	4	116310910	missense	possibly damaging	0.94
R3411:Mast2	UTSW	4	116310910	missense	possibly damaging	0.94
R3435:Mast2	UTSW	4	116308095	missense	probably benign	0.00
R3953:Mast2	UTSW	4	116313729	missense	probably damaging	1.00
R4056:Mast2	UTSW	4	116337501	splice site	probably benign
R4153:Mast2	UTSW	4	116315963	missense	possibly damaging	0.91
R4648:Mast2	UTSW	4	116314839	nonsense	probably null
R4671:Mast2	UTSW	4	116308650	missense	probably damaging	1.00
R4911:Mast2	UTSW	4	116353057	missense	probably benign	0.36
R4980:Mast2	UTSW	4	116317751	missense	probably damaging	1.00
R5322:Mast2	UTSW	4	116333411	critical splice donor site	probably null
R5462:Mast2	UTSW	4	116307458	missense	probably damaging	0.99
R5586:Mast2	UTSW	4	116435563	missense	probably damaging	0.99
R5750:Mast2	UTSW	4	116308889	intron	probably benign
R5771:Mast2	UTSW	4	116333425	missense	possibly damaging	0.60
R5885:Mast2	UTSW	4	116314838	missense	probably damaging	1.00
R6230:Mast2	UTSW	4	116326098	missense	probably damaging	1.00
R6347:Mast2	UTSW	4	116317732	missense	probably damaging	1.00
R6527:Mast2	UTSW	4	116314939	missense	probably damaging	0.99
R6619:Mast2	UTSW	4	116316497	nonsense	probably null
R7070:Mast2	UTSW	4	116310855	missense	probably benign	0.03
R7303:Mast2	UTSW	4	116308311	missense	possibly damaging	0.63
R7822:Mast2	UTSW	4	116312873	missense	probably damaging	1.00
R7843:Mast2	UTSW	4	116353011	missense	probably damaging	0.98
R7918:Mast2	UTSW	4	116435535	missense	possibly damaging	0.50
R7939:Mast2	UTSW	4	116430471	missense	probably benign	0.09
R8052:Mast2	UTSW	4	116312975	missense	probably damaging	0.99
R8115:Mast2	UTSW	4	116435447	missense	probably benign	0.01
R8312:Mast2	UTSW	4	116430486	missense	probably benign
R8398:Mast2	UTSW	4	116308749	missense	probably damaging	1.00
R8477:Mast2	UTSW	4	116307210	missense	probably benign	0.43
R8759:Mast2	UTSW	4	116435560	missense	possibly damaging	0.80
R8832:Mast2	UTSW	4	116311678	critical splice donor site	probably null
R9245:Mast2	UTSW	4	116310504	missense	probably damaging	1.00
R9261:Mast2	UTSW	4	116308703	missense	probably damaging	1.00
R9530:Mast2	UTSW	4	116312338	missense	probably damaging	1.00
R9642:Mast2	UTSW	4	116313769	missense	probably damaging	0.99
R9709:Mast2	UTSW	4	116315847	missense	probably damaging	1.00
R9745:Mast2	UTSW	4	116310618	missense	probably benign	0.00
R9746:Mast2	UTSW	4	116311730	missense	probably benign	0.01
R9752:Mast2	UTSW	4	116322311	missense	probably benign	0.06
X0003:Mast2	UTSW	4	116307647	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGCGGGAAGGTGCTAACTTC -3'
(R):5'- ATCCAAAGTAGGAGGGAATTCC -3'

Sequencing Primer
(F):5'- GAAGGTGCTAACTTCTTCTCAGCAG -3'
(R):5'- TGCTGGCTCTGGACATACAC -3'

Posted On

2015-02-18