Incidental Mutation 'R3434:Vmn1r209'
ID266361
Institutional Source Beutler Lab
Gene Symbol Vmn1r209
Ensembl Gene ENSMUSG00000071491
Gene Namevomeronasal 1 receptor 209
SynonymsGm11315
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22800629-22809682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22806097 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 141 (M141K)
Ref Sequence ENSEMBL: ENSMUSP00000153997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095961] [ENSMUST00000227038] [ENSMUST00000227265]
Predicted Effect probably benign
Transcript: ENSMUST00000095961
AA Change: M141K

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093657
Gene: ENSMUSG00000071491
AA Change: M141K

DomainStartEndE-ValueType
Pfam:TAS2R 2 294 9.8e-9 PFAM
Pfam:V1R 34 297 3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227038
AA Change: M141K

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000227265
AA Change: M141K

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Drg2 A T 11: 60,461,392 K180* probably null Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Vmn1r209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Vmn1r209 APN 13 22806280 missense probably damaging 1.00
IGL01788:Vmn1r209 APN 13 22805662 missense probably damaging 0.97
IGL02738:Vmn1r209 APN 13 22806120 nonsense probably null
IGL03177:Vmn1r209 APN 13 22805854 missense possibly damaging 0.46
IGL03199:Vmn1r209 APN 13 22806050 missense possibly damaging 0.89
R0437:Vmn1r209 UTSW 13 22806356 missense probably benign 0.01
R0497:Vmn1r209 UTSW 13 22805948 missense probably damaging 1.00
R0506:Vmn1r209 UTSW 13 22805944 missense probably damaging 0.98
R1496:Vmn1r209 UTSW 13 22805764 missense probably damaging 1.00
R1644:Vmn1r209 UTSW 13 22806482 missense possibly damaging 0.52
R1829:Vmn1r209 UTSW 13 22806239 missense possibly damaging 0.95
R2360:Vmn1r209 UTSW 13 22805666 missense probably damaging 1.00
R3435:Vmn1r209 UTSW 13 22806097 missense probably benign 0.04
R4082:Vmn1r209 UTSW 13 22805615 missense probably null 0.15
R4451:Vmn1r209 UTSW 13 22806498 missense probably benign 0.02
R4616:Vmn1r209 UTSW 13 22805965 missense probably damaging 1.00
R4618:Vmn1r209 UTSW 13 22806449 missense possibly damaging 0.87
R4801:Vmn1r209 UTSW 13 22805656 missense probably damaging 1.00
R4802:Vmn1r209 UTSW 13 22805656 missense probably damaging 1.00
R6035:Vmn1r209 UTSW 13 22806032 missense probably benign 0.02
R6035:Vmn1r209 UTSW 13 22806032 missense probably benign 0.02
R6908:Vmn1r209 UTSW 13 22806230 missense possibly damaging 0.60
R7162:Vmn1r209 UTSW 13 22805958 missense probably damaging 1.00
R7772:Vmn1r209 UTSW 13 22806494 missense possibly damaging 0.77
R8328:Vmn1r209 UTSW 13 22806473 missense probably benign 0.00
R8335:Vmn1r209 UTSW 13 22805807 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAAATACCATGTAGCCACTGG -3'
(R):5'- TTGCCAAAGACAGTAGCAGC -3'

Sequencing Primer
(F):5'- ACTGGCCCCTCCCATAG -3'
(R):5'- GGTTTGAGAAACTTCCTAGATGCC -3'
Posted On2015-02-18