Incidental Mutation 'R3434:Drg2'
ID266357
Institutional Source Beutler Lab
Gene Symbol Drg2
Ensembl Gene ENSMUSG00000020537
Gene Namedevelopmentally regulated GTP binding protein 2
Synonyms
MMRRC Submission 040652-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R3434 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location60454591-60468754 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 60461392 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 180 (K180*)
Ref Sequence ENSEMBL: ENSMUSP00000018568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018568]
Predicted Effect probably null
Transcript: ENSMUST00000018568
AA Change: K180*
SMART Domains Protein: ENSMUSP00000018568
Gene: ENSMUSG00000020537
AA Change: K180*

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:FeoB_N 63 169 1.4e-10 PFAM
Pfam:MMR_HSR1 64 180 1.5e-19 PFAM
Pfam:MMR_HSR1_Xtn 184 289 9.6e-50 PFAM
Pfam:TGS 290 363 2.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155731
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTP-binding protein known to function in the regulation of cell growth and differentiation. Read-through transcripts containing this gene and a downstream gene have been identified, but they are not thought to encode a fusion protein. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,289,537 A1008V probably damaging Het
Adora3 A G 3: 105,904,915 K39R probably benign Het
Ankib1 A G 5: 3,692,760 V1085A probably damaging Het
Atp7a G A X: 106,094,857 R563K probably benign Het
Azin1 T C 15: 38,493,576 I268V probably benign Het
Carm1 T C 9: 21,569,473 F81S probably damaging Het
Ccnjl A G 11: 43,579,861 Y152C probably damaging Het
Chrna3 T A 9: 55,024,326 I61F possibly damaging Het
Clca3a2 G A 3: 144,808,761 probably benign Het
Clstn2 T A 9: 97,454,715 D903V probably benign Het
Dpysl3 C T 18: 43,361,061 V70I probably benign Het
Dync2h1 A C 9: 7,011,236 H3659Q probably benign Het
Dysf A T 6: 84,070,888 Y349F probably benign Het
Epb41l4b T C 4: 57,040,865 N533D probably benign Het
Fam47e T A 5: 92,585,362 V152D probably damaging Het
Fasn G A 11: 120,822,773 A24V probably damaging Het
Fhl4 T C 10: 85,098,444 T158A probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Hdlbp A T 1: 93,428,161 M358K probably benign Het
Ift74 A G 4: 94,621,852 probably null Het
Lhx4 A G 1: 155,702,401 Y332H probably damaging Het
Mast2 A T 4: 116,308,095 S1314T probably benign Het
Mast4 A G 13: 102,787,379 I508T probably damaging Het
Mdn1 T C 4: 32,733,726 probably null Het
Mrps23 A G 11: 88,210,114 K44E probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mup6 G T 4: 60,004,116 probably null Het
Notch3 A T 17: 32,158,618 D161E possibly damaging Het
Olfr1131 T C 2: 87,629,074 F204L probably benign Het
Olfr1200 T C 2: 88,768,069 D82G probably damaging Het
Olfr695 A T 7: 106,873,769 Y159N probably benign Het
P2rx4 T A 5: 122,725,070 I202K probably damaging Het
Phykpl A G 11: 51,598,655 T363A probably benign Het
Pitpnm1 G A 19: 4,112,234 A1047T probably damaging Het
Ppat A G 5: 76,918,065 I402T probably damaging Het
Rpgr A G X: 10,176,602 S656P probably benign Het
Rsbn1l T C 5: 20,905,930 probably benign Het
Sacs A G 14: 61,212,303 K3933E probably damaging Het
Scn7a T C 2: 66,675,503 I1681V probably benign Het
Sel1l3 T C 5: 53,117,090 D1016G probably benign Het
Sf3a3 C A 4: 124,725,077 T277N possibly damaging Het
Slc35a5 A G 16: 45,144,033 I279T probably benign Het
Slc39a10 T C 1: 46,835,717 T142A probably benign Het
Tle3 T A 9: 61,414,094 probably null Het
Tmem117 T C 15: 95,094,692 I411T probably damaging Het
Ttn T C 2: 76,868,377 T5A possibly damaging Het
Tubgcp3 T C 8: 12,658,381 probably null Het
Ush2a C T 1: 188,733,758 P2841L probably damaging Het
Vmn1r209 A T 13: 22,806,097 M141K probably benign Het
Vmn2r91 A T 17: 18,110,108 probably benign Het
Other mutations in Drg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03019:Drg2 APN 11 60456595 missense probably damaging 1.00
R0356:Drg2 UTSW 11 60461581 missense probably damaging 0.97
R1483:Drg2 UTSW 11 60459527 missense probably damaging 1.00
R1501:Drg2 UTSW 11 60464853 missense probably benign 0.00
R2517:Drg2 UTSW 11 60468128 missense probably damaging 0.96
R3824:Drg2 UTSW 11 60459508 missense possibly damaging 0.85
R3825:Drg2 UTSW 11 60459508 missense possibly damaging 0.85
R3898:Drg2 UTSW 11 60456634 missense probably benign
R4418:Drg2 UTSW 11 60468146 missense probably damaging 1.00
R4732:Drg2 UTSW 11 60461396 critical splice donor site probably null
R4733:Drg2 UTSW 11 60461396 critical splice donor site probably null
R4953:Drg2 UTSW 11 60459436 splice site probably benign
R5492:Drg2 UTSW 11 60461596 missense probably damaging 0.99
R6007:Drg2 UTSW 11 60462625 missense possibly damaging 0.55
R7282:Drg2 UTSW 11 60454693 missense probably benign 0.30
R7417:Drg2 UTSW 11 60454680 start codon destroyed probably null 0.77
R7697:Drg2 UTSW 11 60462177 missense probably damaging 0.98
R7822:Drg2 UTSW 11 60462200 nonsense probably null
R7911:Drg2 UTSW 11 60464175 missense possibly damaging 0.83
R7992:Drg2 UTSW 11 60464175 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGCTCCACCACAGTTTTGGG -3'
(R):5'- CAGAGCATTGTGTCAGTGTG -3'

Sequencing Primer
(F):5'- CTCCACCACAGTTTTGGGATGTTG -3'
(R):5'- TGACTGTTGAGTTAAAGGAGATGCC -3'
Posted On2015-02-18