Mutagenetix > Incidental Mutation

Incidental Mutation 'R3434:Slc39a10'

266322

Institutional Source

Beutler Lab

Gene Symbol

Slc39a10

Ensembl Gene

ENSMUSG00000025986

Gene Name

solute carrier family 39 (zinc transporter), member 10

Synonyms

2900042E17Rik

MMRRC Submission

040652-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.667) question?

Stock #

R3434 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46807544-46892852 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46835717 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 142 (T142A)

Ref Sequence

ENSEMBL: ENSMUSP00000140176 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027131] [ENSMUST00000185520] [ENSMUST00000186852]

AlphaFold

Q6P5F6

Predicted Effect

probably benign
Transcript: ENSMUST00000027131
AA Change: T142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027131
Gene: ENSMUSG00000025986
AA Change: T142A

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	122	134	N/A	INTRINSIC
low complexity region	170	195	N/A	INTRINSIC
low complexity region	224	244	N/A	INTRINSIC
Pfam:Zip	406	607	9.9e-44	PFAM
Pfam:Zip	588	821	2.5e-69	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141226

Predicted Effect

probably benign
Transcript: ENSMUST00000185520

SMART Domains

Protein: ENSMUSP00000140570
Gene: ENSMUSG00000025986

Domain	Start	End	E-Value	Type
low complexity region	30	41	N/A	INTRINSIC
low complexity region	132	144	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186852
AA Change: T142A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000140176
Gene: ENSMUSG00000025986
AA Change: T142A

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	122	134	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A10 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice with conditional loss of function display defects in cellular proliferation and differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	A	17: 24,289,537	A1008V	probably damaging	Het
Adora3	A	G	3: 105,904,915	K39R	probably benign	Het
Ankib1	A	G	5: 3,692,760	V1085A	probably damaging	Het
Atp7a	G	A	X: 106,094,857	R563K	probably benign	Het
Azin1	T	C	15: 38,493,576	I268V	probably benign	Het
Carm1	T	C	9: 21,569,473	F81S	probably damaging	Het
Ccnjl	A	G	11: 43,579,861	Y152C	probably damaging	Het
Chrna3	T	A	9: 55,024,326	I61F	possibly damaging	Het
Clca3a2	G	A	3: 144,808,761		probably benign	Het
Clstn2	T	A	9: 97,454,715	D903V	probably benign	Het
Dpysl3	C	T	18: 43,361,061	V70I	probably benign	Het
Drg2	A	T	11: 60,461,392	K180*	probably null	Het
Dync2h1	A	C	9: 7,011,236	H3659Q	probably benign	Het
Dysf	A	T	6: 84,070,888	Y349F	probably benign	Het
Epb41l4b	T	C	4: 57,040,865	N533D	probably benign	Het
Fam47e	T	A	5: 92,585,362	V152D	probably damaging	Het
Fasn	G	A	11: 120,822,773	A24V	probably damaging	Het
Fhl4	T	C	10: 85,098,444	T158A	probably benign	Het
Fnbp1l	C	T	3: 122,546,306	R499Q	probably damaging	Het
Hdlbp	A	T	1: 93,428,161	M358K	probably benign	Het
Ift74	A	G	4: 94,621,852		probably null	Het
Lhx4	A	G	1: 155,702,401	Y332H	probably damaging	Het
Mast2	A	T	4: 116,308,095	S1314T	probably benign	Het
Mast4	A	G	13: 102,787,379	I508T	probably damaging	Het
Mdn1	T	C	4: 32,733,726		probably null	Het
Mrps23	A	G	11: 88,210,114	K44E	probably damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mup6	G	T	4: 60,004,116		probably null	Het
Notch3	A	T	17: 32,158,618	D161E	possibly damaging	Het
Olfr1131	T	C	2: 87,629,074	F204L	probably benign	Het
Olfr1200	T	C	2: 88,768,069	D82G	probably damaging	Het
Olfr695	A	T	7: 106,873,769	Y159N	probably benign	Het
P2rx4	T	A	5: 122,725,070	I202K	probably damaging	Het
Phykpl	A	G	11: 51,598,655	T363A	probably benign	Het
Pitpnm1	G	A	19: 4,112,234	A1047T	probably damaging	Het
Ppat	A	G	5: 76,918,065	I402T	probably damaging	Het
Rpgr	A	G	X: 10,176,602	S656P	probably benign	Het
Rsbn1l	T	C	5: 20,905,930		probably benign	Het
Sacs	A	G	14: 61,212,303	K3933E	probably damaging	Het
Scn7a	T	C	2: 66,675,503	I1681V	probably benign	Het
Sel1l3	T	C	5: 53,117,090	D1016G	probably benign	Het
Sf3a3	C	A	4: 124,725,077	T277N	possibly damaging	Het
Slc35a5	A	G	16: 45,144,033	I279T	probably benign	Het
Tle3	T	A	9: 61,414,094		probably null	Het
Tmem117	T	C	15: 95,094,692	I411T	probably damaging	Het
Ttn	T	C	2: 76,868,377	T5A	possibly damaging	Het
Tubgcp3	T	C	8: 12,658,381		probably null	Het
Ush2a	C	T	1: 188,733,758	P2841L	probably damaging	Het
Vmn1r209	A	T	13: 22,806,097	M141K	probably benign	Het
Vmn2r91	A	T	17: 18,110,108		probably benign	Het

Other mutations in Slc39a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00543:Slc39a10	APN	1	46819057	splice site	probably benign
IGL01628:Slc39a10	APN	1	46835523	missense	probably benign	0.23
IGL01939:Slc39a10	APN	1	46832735	missense	probably benign	0.07
IGL02068:Slc39a10	APN	1	46819439	splice site	probably benign
IGL02093:Slc39a10	APN	1	46835209	missense	probably damaging	1.00
IGL02101:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02122:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02125:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02171:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02175:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02186:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02699:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
IGL02700:Slc39a10	APN	1	46818128	missense	probably damaging	1.00
R0217:Slc39a10	UTSW	1	46835540	missense	probably benign
R0704:Slc39a10	UTSW	1	46835861	missense	possibly damaging	0.76
R0782:Slc39a10	UTSW	1	46835996	missense	probably damaging	0.97
R1527:Slc39a10	UTSW	1	46819262	missense	probably benign
R1566:Slc39a10	UTSW	1	46836085	missense	possibly damaging	0.90
R1568:Slc39a10	UTSW	1	46826215	missense	probably benign	0.00
R1664:Slc39a10	UTSW	1	46826109	missense	probably damaging	1.00
R1830:Slc39a10	UTSW	1	46836070	missense	probably damaging	1.00
R1954:Slc39a10	UTSW	1	46835174	missense	possibly damaging	0.50
R2327:Slc39a10	UTSW	1	46835996	missense	probably damaging	0.97
R3761:Slc39a10	UTSW	1	46812125	missense	possibly damaging	0.88
R4035:Slc39a10	UTSW	1	46812074	missense	probably damaging	1.00
R4419:Slc39a10	UTSW	1	46810066	missense	probably benign	0.42
R4675:Slc39a10	UTSW	1	46817984	intron	probably benign
R4689:Slc39a10	UTSW	1	46836013	missense	probably benign	0.00
R5310:Slc39a10	UTSW	1	46836125	missense	probably damaging	1.00
R6073:Slc39a10	UTSW	1	46832612	missense	possibly damaging	0.68
R6161:Slc39a10	UTSW	1	46827407	missense	probably damaging	1.00
R6199:Slc39a10	UTSW	1	46835833	missense	probably damaging	1.00
R6562:Slc39a10	UTSW	1	46835564	missense	probably benign	0.02
R7087:Slc39a10	UTSW	1	46835720	missense	probably damaging	1.00
R7222:Slc39a10	UTSW	1	46819292	missense	possibly damaging	0.82
R7286:Slc39a10	UTSW	1	46810070	missense	probably damaging	0.97
R7568:Slc39a10	UTSW	1	46835130	missense	probably benign	0.14
R7891:Slc39a10	UTSW	1	46812168	missense	probably damaging	1.00
R7918:Slc39a10	UTSW	1	46835752	missense	possibly damaging	0.88
R9725:Slc39a10	UTSW	1	46810063	missense	probably damaging	1.00
RF020:Slc39a10	UTSW	1	46810015	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTGACTTCACTTCAGACTGC -3'
(R):5'- TAACAAACTTGGGCCTTGGAG -3'

Sequencing Primer
(F):5'- TCACTGTGAGCAACGGAGTC -3'
(R):5'- CCTTGGAGAGATCAAAGTCGTTG -3'

Posted On

2015-02-18