Incidental Mutation 'R3620:Slc10a2'
ID268596
Institutional Source Beutler Lab
Gene Symbol Slc10a2
Ensembl Gene ENSMUSG00000023073
Gene Namesolute carrier family 10, member 2
SynonymsASBT
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3620 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location5083219-5105351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5104909 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 92 (I92N)
Ref Sequence ENSEMBL: ENSMUSP00000023835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023835]
Predicted Effect probably damaging
Transcript: ENSMUST00000023835
AA Change: I92N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023835
Gene: ENSMUSG00000023073
AA Change: I92N

DomainStartEndE-ValueType
Pfam:SBF 39 220 1e-47 PFAM
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
Meta Mutation Damage Score 0.1632 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/bile acid cotransporter. This transporter is the primary mechanism for uptake of intestinal bile acids by apical cells in the distal ileum. Bile acids are the catabolic product of cholesterol metabolism, so this protein is also critical for cholesterol homeostasis. Mutations in this gene cause primary bile acid malabsorption (PBAM); muatations in this gene may also be associated with other diseases of the liver and intestines, such as familial hypertriglyceridemia (FHTG). [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially indistinguishable from wild-type in terms of survival, gross appearance and behavior. However, they do have defects in lipid absorption from the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Asxl1 C A 2: 153,357,155 R76S probably damaging Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Slc10a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc10a2 APN 8 5091668 missense probably damaging 0.96
IGL00504:Slc10a2 APN 8 5091667 missense probably benign 0.00
IGL00596:Slc10a2 APN 8 5091680 missense probably benign 0.00
IGL01472:Slc10a2 APN 8 5091652 missense probably damaging 1.00
IGL02679:Slc10a2 APN 8 5098499 missense probably damaging 1.00
gall UTSW 8 5091621 critical splice donor site probably null
R0560:Slc10a2 UTSW 8 5089092 missense probably benign 0.02
R0629:Slc10a2 UTSW 8 5098562 missense probably benign 0.30
R0743:Slc10a2 UTSW 8 5089132 missense probably damaging 0.99
R0970:Slc10a2 UTSW 8 5105115 missense probably benign 0.00
R1033:Slc10a2 UTSW 8 5104889 missense probably damaging 0.99
R1557:Slc10a2 UTSW 8 5091755 missense probably damaging 1.00
R1808:Slc10a2 UTSW 8 5104856 missense probably damaging 0.96
R4084:Slc10a2 UTSW 8 5089126 missense possibly damaging 0.71
R4112:Slc10a2 UTSW 8 5105135 missense probably benign
R5693:Slc10a2 UTSW 8 5105128 missense probably damaging 1.00
R6294:Slc10a2 UTSW 8 5091621 critical splice donor site probably null
R6459:Slc10a2 UTSW 8 5098581 splice site probably null
R7442:Slc10a2 UTSW 8 5089086 missense possibly damaging 0.80
Z1177:Slc10a2 UTSW 8 5098448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCAGATCAAATGGATGTTG -3'
(R):5'- TACCTGAGAGCAACTTCAATGC -3'

Sequencing Primer
(F):5'- GCAGATCAAATGGATGTTGAAAAAG -3'
(R):5'- CTGAGAGCAACTTCAATGCAATTCTC -3'
Posted On2015-02-19