Incidental Mutation 'R3620:Asxl1'
ID268587
Institutional Source Beutler Lab
Gene Symbol Asxl1
Ensembl Gene ENSMUSG00000042548
Gene Nameadditional sex combs like 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3620 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153345829-153404007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 153357155 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 76 (R76S)
Ref Sequence ENSEMBL: ENSMUSP00000154224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]
Predicted Effect probably damaging
Transcript: ENSMUST00000109790
AA Change: R77S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: R77S

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-20 PFAM
low complexity region 199 209 N/A INTRINSIC
Pfam:ASXH 236 361 5.9e-40 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
Pfam:PHD_3 1446 1512 6.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144722
Predicted Effect probably damaging
Transcript: ENSMUST00000227428
AA Change: R76S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,008,032 M473T probably benign Het
Bhlhe41 C A 6: 145,863,007 G360C possibly damaging Het
Ccdc88a T C 11: 29,430,227 I201T probably benign Het
Ccng1 T C 11: 40,752,165 T152A probably benign Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Cldn16 T A 16: 26,477,552 F93I possibly damaging Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fah T C 7: 84,588,951 probably null Het
Fat2 A T 11: 55,256,695 V3907D probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Gramd1b C A 9: 40,455,546 R42L probably benign Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hist1h2bh C A 13: 23,543,154 V67L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Igsf10 T G 3: 59,336,331 D194A probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lrpprc A T 17: 84,770,024 C412S probably benign Het
Mga T A 2: 119,916,668 D433E probably damaging Het
Myo15 A T 11: 60,478,642 S743C possibly damaging Het
Myo15b T G 11: 115,871,187 L1176R possibly damaging Het
Ndor1 T C 2: 25,248,035 Q526R probably damaging Het
Nipbl A G 15: 8,333,024 I1429T probably damaging Het
Olfr1261 T C 2: 89,993,852 I153T probably damaging Het
Olfr1282 T A 2: 111,335,344 I245L probably benign Het
Olfr412 T A 11: 74,365,224 L185Q probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pa2g4 C G 10: 128,563,595 E67Q probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Prdm13 A G 4: 21,683,532 Y143H unknown Het
Rad23a A G 8: 84,840,564 M1T probably null Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Slc10a2 A T 8: 5,104,909 I92N probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Sox11 T C 12: 27,341,736 T225A probably benign Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Unc45a G T 7: 80,334,051 N332K possibly damaging Het
Vmn1r159 A C 7: 22,842,833 I258S possibly damaging Het
Wdr31 A T 4: 62,457,464 F251L possibly damaging Het
Wdr43 C T 17: 71,650,606 T530M probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Other mutations in Asxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Asxl1 APN 2 153392940 splice site probably benign
IGL01432:Asxl1 APN 2 153400205 missense probably benign 0.38
IGL01543:Asxl1 APN 2 153401484 missense probably benign 0.11
IGL02355:Asxl1 APN 2 153401786 missense probably benign 0.34
IGL02362:Asxl1 APN 2 153401786 missense probably benign 0.34
IGL02645:Asxl1 APN 2 153392857 missense possibly damaging 0.94
IGL02696:Asxl1 APN 2 153400195 nonsense probably null
IGL03365:Asxl1 APN 2 153401754 missense probably damaging 1.00
IGL03372:Asxl1 APN 2 153400413 missense probably damaging 0.99
IGL03377:Asxl1 APN 2 153396780 missense probably damaging 1.00
astrophel UTSW 2 153400106 missense possibly damaging 0.75
hairbrush UTSW 2 153400724 missense possibly damaging 0.55
R0044:Asxl1 UTSW 2 153400209 missense probably benign 0.06
R0044:Asxl1 UTSW 2 153400209 missense probably benign 0.06
R0600:Asxl1 UTSW 2 153399904 missense probably benign 0.00
R0659:Asxl1 UTSW 2 153400724 missense possibly damaging 0.55
R0661:Asxl1 UTSW 2 153400724 missense possibly damaging 0.55
R0684:Asxl1 UTSW 2 153397522 missense probably damaging 1.00
R1606:Asxl1 UTSW 2 153400455 missense probably damaging 0.99
R1747:Asxl1 UTSW 2 153393454 missense possibly damaging 0.86
R1796:Asxl1 UTSW 2 153401606 missense probably benign 0.31
R1914:Asxl1 UTSW 2 153401906 missense probably damaging 1.00
R2099:Asxl1 UTSW 2 153352267 missense possibly damaging 0.95
R2373:Asxl1 UTSW 2 153401900 missense probably benign 0.13
R2910:Asxl1 UTSW 2 153401039 missense probably benign 0.00
R3701:Asxl1 UTSW 2 153399344 missense probably benign 0.04
R4200:Asxl1 UTSW 2 153400106 missense possibly damaging 0.75
R4773:Asxl1 UTSW 2 153401985 missense probably damaging 1.00
R4902:Asxl1 UTSW 2 153399831 missense probably benign 0.02
R5100:Asxl1 UTSW 2 153397931 missense probably damaging 1.00
R5102:Asxl1 UTSW 2 153400955 missense probably benign 0.00
R5166:Asxl1 UTSW 2 153401121 missense probably damaging 1.00
R5421:Asxl1 UTSW 2 153399584 missense probably benign 0.04
R5701:Asxl1 UTSW 2 153399489 missense probably damaging 1.00
R5861:Asxl1 UTSW 2 153399390 missense probably damaging 0.99
R5973:Asxl1 UTSW 2 153402011 missense probably damaging 0.97
R6384:Asxl1 UTSW 2 153391824 critical splice donor site probably null
R7023:Asxl1 UTSW 2 153400549 missense probably benign 0.00
R7028:Asxl1 UTSW 2 153400107 missense probably benign 0.00
R7176:Asxl1 UTSW 2 153401988 missense probably damaging 1.00
R7297:Asxl1 UTSW 2 153397435 missense probably benign 0.01
R7378:Asxl1 UTSW 2 153401993 missense probably damaging 1.00
R7464:Asxl1 UTSW 2 153397785 missense probably benign 0.01
R7678:Asxl1 UTSW 2 153400652 missense probably damaging 1.00
R7686:Asxl1 UTSW 2 153391614 missense probably damaging 1.00
R7789:Asxl1 UTSW 2 153400023 missense probably benign 0.00
R7838:Asxl1 UTSW 2 153396813 missense probably damaging 1.00
R7898:Asxl1 UTSW 2 153399934 missense possibly damaging 0.65
R7921:Asxl1 UTSW 2 153396813 missense probably damaging 1.00
R7981:Asxl1 UTSW 2 153399934 missense possibly damaging 0.65
X0024:Asxl1 UTSW 2 153401985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCACTGCTTTCACAATAGGTTTG -3'
(R):5'- CATCTCAGAGTACCATTGAGGAC -3'

Sequencing Primer
(F):5'- AGGTTTGTGAAAACATTGCTTCTG -3'
(R):5'- CCAAGACATTAGTGATACCTGACTGG -3'
Posted On2015-02-19