Mutagenetix > Incidental Mutation

Incidental Mutation 'R3688:Vmn2r75'

269619

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r75

Ensembl Gene

ENSMUSG00000090436

Gene Name

vomeronasal 2, receptor 75

Synonyms

EG546981

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R3688 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86148042-86171724 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 86148421 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 728 (H728L)

Ref Sequence

ENSEMBL: ENSMUSP00000126973 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167830]

AlphaFold

G5E8Z7

Predicted Effect

probably damaging
Transcript: ENSMUST00000167830
AA Change: H728L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126973
Gene: ENSMUSG00000090436
AA Change: H728L

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	80	466	2.8e-31	PFAM
Pfam:NCD3G	510	562	4.6e-20	PFAM
Pfam:7tm_3	593	829	7.7e-51	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,267,849	I687T	possibly damaging	Het
7420426K07Rik	A	T	9: 98,903,464	M61L	probably benign	Het
A1cf	T	A	19: 31,911,169	F100I	probably damaging	Het
Adam12	A	T	7: 133,964,796	Y308*	probably null	Het
Adam3	T	C	8: 24,703,848	T383A	probably benign	Het
Adcy8	T	C	15: 64,871,707	T351A	probably damaging	Het
Atp11c	T	C	X: 60,281,644	Y431C	probably benign	Het
Atp7b	T	C	8: 22,004,230	H956R	probably damaging	Het
Bptf	C	A	11: 107,074,198	R1275L	probably benign	Het
Cept1	G	T	3: 106,520,015	N236K	probably benign	Het
Col15a1	C	T	4: 47,258,689	T360I	probably benign	Het
Efcab6	G	A	15: 83,871,278	Q1323*	probably null	Het
Efl1	T	A	7: 82,762,970	S856T	probably benign	Het
Eftud2	T	C	11: 102,844,201	E624G	probably damaging	Het
Fat2	T	C	11: 55,281,101	T2929A	probably damaging	Het
Gm4884	A	G	7: 41,043,486	H293R	possibly damaging	Het
Hdac10	C	T	15: 89,123,564		probably null	Het
Il17rd	C	A	14: 27,039,148	N15K	probably null	Het
Kcnt1	C	T	2: 25,894,359	T258I	probably damaging	Het
Kif5a	T	G	10: 127,242,774	N334T	probably damaging	Het
Ksr2	A	G	5: 117,554,979	Q164R	probably damaging	Het
Map4k4	T	A	1: 39,985,171		probably null	Het
Nat6	T	C	9: 107,583,350	V148A	possibly damaging	Het
Olfr459	G	T	6: 41,772,226	Y24*	probably null	Het
Pard3b	A	G	1: 62,479,569	T938A	probably benign	Het
Pcdhga6	T	A	18: 37,708,541	I438N	probably damaging	Het
Pfkm	T	A	15: 98,131,517	N697K	probably benign	Het
Pus10	T	C	11: 23,667,334	F16L	probably benign	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rangap1	A	T	15: 81,718,762	M154K	possibly damaging	Het
Slc25a17	A	G	15: 81,327,284	F177S	probably benign	Het
Slc34a2	G	A	5: 53,064,832	G289S	probably benign	Het
Strn4	A	G	7: 16,822,581	Y123C	probably damaging	Het
Swt1	A	T	1: 151,391,489	M647K	probably damaging	Het
Trpm5	A	G	7: 143,078,456	V872A	probably damaging	Het
Ubqln4	T	C	3: 88,563,159	S313P	probably damaging	Het
Vmn1r17	T	A	6: 57,360,559	T225S	probably damaging	Het
Vps33a	T	C	5: 123,535,211		probably null	Het
Vwde	T	A	6: 13,186,892	R865S	probably damaging	Het
Zfp408	T	A	2: 91,646,432	M126L	probably benign	Het

Other mutations in Vmn2r75

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Vmn2r75	APN	7	86148032	unclassified	probably benign
IGL01287:Vmn2r75	APN	7	86148593	missense	probably damaging	0.97
IGL01318:Vmn2r75	APN	7	86165566	missense	probably benign	0.06
IGL01331:Vmn2r75	APN	7	86171662	nonsense	probably null
IGL01406:Vmn2r75	APN	7	86163292	splice site	probably benign
IGL01615:Vmn2r75	APN	7	86148473	missense	probably benign	0.03
IGL01657:Vmn2r75	APN	7	86164247	missense	probably damaging	1.00
IGL02237:Vmn2r75	APN	7	86165578	missense	possibly damaging	0.88
IGL02275:Vmn2r75	APN	7	86165140	missense	probably benign	0.04
IGL02307:Vmn2r75	APN	7	86165766	missense	probably benign	0.00
IGL03136:Vmn2r75	APN	7	86148703	missense	possibly damaging	0.89
IGL03160:Vmn2r75	APN	7	86148436	missense	probably damaging	1.00
IGL03244:Vmn2r75	APN	7	86171725	unclassified	probably benign
PIT4449001:Vmn2r75	UTSW	7	86165583	missense	probably damaging	1.00
R0049:Vmn2r75	UTSW	7	86148101	nonsense	probably null
R0049:Vmn2r75	UTSW	7	86148101	nonsense	probably null
R0083:Vmn2r75	UTSW	7	86165658	missense	probably benign	0.00
R0108:Vmn2r75	UTSW	7	86165658	missense	probably benign	0.00
R0276:Vmn2r75	UTSW	7	86148307	missense	probably benign	0.01
R0320:Vmn2r75	UTSW	7	86165080	missense	probably benign	0.36
R0471:Vmn2r75	UTSW	7	86165513	missense	probably benign	0.01
R0562:Vmn2r75	UTSW	7	86148241	nonsense	probably null
R0631:Vmn2r75	UTSW	7	86163270	missense	probably null	1.00
R0661:Vmn2r75	UTSW	7	86165658	missense	probably benign	0.00
R0811:Vmn2r75	UTSW	7	86165367	missense	probably benign	0.38
R0812:Vmn2r75	UTSW	7	86165367	missense	probably benign	0.38
R0891:Vmn2r75	UTSW	7	86164268	missense	possibly damaging	0.81
R1340:Vmn2r75	UTSW	7	86148590	missense	probably damaging	0.98
R1501:Vmn2r75	UTSW	7	86165642	missense	possibly damaging	0.85
R1760:Vmn2r75	UTSW	7	86148811	missense	probably damaging	1.00
R1970:Vmn2r75	UTSW	7	86148262	missense	probably damaging	1.00
R2060:Vmn2r75	UTSW	7	86165164	missense	probably benign	0.00
R2292:Vmn2r75	UTSW	7	86148936	missense	probably damaging	1.00
R3892:Vmn2r75	UTSW	7	86164286	missense	probably null	1.00
R4532:Vmn2r75	UTSW	7	86148141	nonsense	probably null
R4583:Vmn2r75	UTSW	7	86164082	missense	possibly damaging	0.81
R4592:Vmn2r75	UTSW	7	86166286	missense	probably benign	0.00
R4792:Vmn2r75	UTSW	7	86163170	missense	possibly damaging	0.46
R4859:Vmn2r75	UTSW	7	86148403	missense	probably benign	0.35
R4896:Vmn2r75	UTSW	7	86171579	missense	probably benign	0.01
R4943:Vmn2r75	UTSW	7	86165497	missense	probably damaging	1.00
R4992:Vmn2r75	UTSW	7	86166167	critical splice donor site	probably null
R5048:Vmn2r75	UTSW	7	86165527	missense	possibly damaging	0.66
R5063:Vmn2r75	UTSW	7	86164164	missense	probably benign
R5156:Vmn2r75	UTSW	7	86164228	missense	possibly damaging	0.51
R5243:Vmn2r75	UTSW	7	86164239	missense	probably damaging	1.00
R5277:Vmn2r75	UTSW	7	86166292	missense	probably benign
R5574:Vmn2r75	UTSW	7	86166302	missense	probably benign	0.22
R5622:Vmn2r75	UTSW	7	86148494	missense	probably benign	0.15
R5680:Vmn2r75	UTSW	7	86171571	missense	probably benign	0.10
R5884:Vmn2r75	UTSW	7	86165370	missense	probably benign
R6021:Vmn2r75	UTSW	7	86171612	missense	probably benign	0.01
R6217:Vmn2r75	UTSW	7	86166167	critical splice donor site	probably benign
R6242:Vmn2r75	UTSW	7	86165384	missense	probably damaging	1.00
R6299:Vmn2r75	UTSW	7	86165274	missense	probably benign	0.12
R6441:Vmn2r75	UTSW	7	86171576	missense	probably damaging	0.99
R6495:Vmn2r75	UTSW	7	86164079	missense	probably benign	0.00
R6553:Vmn2r75	UTSW	7	86164245	missense	probably benign	0.28
R6670:Vmn2r75	UTSW	7	86148436	missense	probably damaging	1.00
R7078:Vmn2r75	UTSW	7	86166360	missense	probably damaging	1.00
R7164:Vmn2r75	UTSW	7	86165384	missense	probably damaging	1.00
R8411:Vmn2r75	UTSW	7	86148514	missense	probably damaging	1.00
R8507:Vmn2r75	UTSW	7	86148477	nonsense	probably null
R8559:Vmn2r75	UTSW	7	86166272	missense	possibly damaging	0.65
R8677:Vmn2r75	UTSW	7	86165202	missense	possibly damaging	0.86
R8708:Vmn2r75	UTSW	7	86163268	missense	probably damaging	0.99
R8778:Vmn2r75	UTSW	7	86164289	missense	probably benign	0.40
R8968:Vmn2r75	UTSW	7	86171557	nonsense	probably null
R9145:Vmn2r75	UTSW	7	86164239	missense	probably damaging	1.00
R9316:Vmn2r75	UTSW	7	86148105	missense	possibly damaging	0.63
R9363:Vmn2r75	UTSW	7	86166215	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGTGATCCAGACACTGCAGAAC -3'
(R):5'- TTGCATTCACTGTGGCTGCC -3'

Sequencing Primer
(F):5'- CACCAGCATGCTAAATGTCAAGAG -3'
(R):5'- CTGTCTTGGCCAAAACGATTACTG -3'

Posted On

2015-02-19