Incidental Mutation 'R9145:Vmn2r75'
ID 694564
Institutional Source Beutler Lab
Gene Symbol Vmn2r75
Ensembl Gene ENSMUSG00000090436
Gene Name vomeronasal 2, receptor 75
Synonyms EG546981
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R9145 (G1)
Quality Score 170.009
Status Validated
Chromosome 7
Chromosomal Location 85797250-85820932 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85813447 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 452 (N452D)
Ref Sequence ENSEMBL: ENSMUSP00000126973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167830]
AlphaFold G5E8Z7
Predicted Effect probably damaging
Transcript: ENSMUST00000167830
AA Change: N452D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126973
Gene: ENSMUSG00000090436
AA Change: N452D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 80 466 2.8e-31 PFAM
Pfam:NCD3G 510 562 4.6e-20 PFAM
Pfam:7tm_3 593 829 7.7e-51 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,536,032 (GRCm39) H720L probably benign Het
Abca15 T C 7: 119,987,388 (GRCm39) Y1225H probably benign Het
Adck1 C A 12: 88,335,193 (GRCm39) N26K probably benign Het
Adcy3 A G 12: 4,245,208 (GRCm39) D382G probably damaging Het
Ahi1 T A 10: 20,876,488 (GRCm39) C800S probably benign Het
Ahnak G T 19: 8,992,287 (GRCm39) V4524L probably benign Het
Aoc1l1 C A 6: 48,952,890 (GRCm39) R272S probably benign Het
Apol11a C T 15: 77,397,778 (GRCm39) A43V probably benign Het
Arid1a T C 4: 133,421,214 (GRCm39) M479V unknown Het
Atp13a2 T A 4: 140,724,056 (GRCm39) C324S probably damaging Het
C2cd2 T G 16: 97,677,486 (GRCm39) T413P probably damaging Het
Cct5 A C 15: 31,591,107 (GRCm39) D531E Het
Chst1 A T 2: 92,444,523 (GRCm39) I332F probably damaging Het
Col12a1 A T 9: 79,527,344 (GRCm39) V2662D probably benign Het
Cts3 A G 13: 61,712,800 (GRCm39) Y307H probably benign Het
D630023F18Rik G A 1: 65,160,371 (GRCm39) probably benign Het
Dhx9 A G 1: 153,336,826 (GRCm39) I807T probably damaging Het
Exoc3l4 T C 12: 111,388,586 (GRCm39) L25P probably benign Het
Ggcx T A 6: 72,402,905 (GRCm39) C288S probably benign Het
Gjb3 A G 4: 127,220,140 (GRCm39) Y131H probably damaging Het
Hdhd3 A G 4: 62,417,574 (GRCm39) S201P probably benign Het
Helz2 A T 2: 180,881,848 (GRCm39) V315E probably damaging Het
Hsp90aa1 A G 12: 110,662,684 (GRCm39) probably null Het
Ift70a1 A T 2: 75,810,423 (GRCm39) Y553* probably null Het
Il12a C T 3: 68,598,875 (GRCm39) R19W unknown Het
Isoc1 C T 18: 58,806,347 (GRCm39) A219V possibly damaging Het
Jup T A 11: 100,269,124 (GRCm39) T430S probably benign Het
Klra5 C T 6: 129,886,911 (GRCm39) C39Y probably benign Het
Map4 A T 9: 109,855,268 (GRCm39) Q131L probably damaging Het
Mau2 T A 8: 70,480,165 (GRCm39) K314M probably damaging Het
Mga A G 2: 119,794,493 (GRCm39) M2726V probably benign Het
Mgme1 G A 2: 144,114,405 (GRCm39) probably null Het
Msrb2 A G 2: 19,399,066 (GRCm39) E143G probably benign Het
Muc5b G T 7: 141,411,350 (GRCm39) C1432F unknown Het
Naglu T C 11: 100,961,940 (GRCm39) Y138H probably damaging Het
Nicn1 C T 9: 108,171,708 (GRCm39) R163C possibly damaging Het
Nlrp1b A G 11: 71,109,193 (GRCm39) Y103H probably benign Het
Nodal A G 10: 61,259,459 (GRCm39) N299D probably damaging Het
Notch1 T C 2: 26,349,587 (GRCm39) T2518A probably benign Het
Nr2e1 A C 10: 42,448,948 (GRCm39) S97A probably benign Het
Nuak1 A T 10: 84,210,587 (GRCm39) S500R probably benign Het
Nxt2 C T X: 141,020,747 (GRCm39) A118V possibly damaging Het
Nyap1 T C 5: 137,736,175 (GRCm39) E104G probably benign Het
Or3a1b C T 11: 74,012,526 (GRCm39) T137I probably benign Het
Or52e18 T A 7: 104,609,204 (GRCm39) H245L probably damaging Het
Palld T C 8: 62,330,107 (GRCm39) T257A probably benign Het
Pcnx4 C T 12: 72,603,043 (GRCm39) P435L probably damaging Het
Piezo1 T C 8: 123,208,753 (GRCm39) T2538A unknown Het
Plagl1 T C 10: 13,003,872 (GRCm39) L380P unknown Het
Polrmt G T 10: 79,576,415 (GRCm39) Q514K probably benign Het
Psg17 T G 7: 18,553,851 (GRCm39) D133A probably benign Het
Rab3b G A 4: 108,797,903 (GRCm39) D185N probably benign Het
Ranbp2 T A 10: 58,291,736 (GRCm39) S248T probably benign Het
Rdh10 C A 1: 16,199,430 (GRCm39) A212D probably damaging Het
Rinl A G 7: 28,495,089 (GRCm39) H154R Het
Selenbp1 T C 3: 94,851,414 (GRCm39) M389T probably benign Het
Serpina1c T A 12: 103,862,400 (GRCm39) H305L possibly damaging Het
Sh3rf2 T A 18: 42,282,746 (GRCm39) S467T Het
Sipa1l1 A G 12: 82,443,335 (GRCm39) D875G probably benign Het
Slc10a6 A T 5: 103,776,800 (GRCm39) V100D probably damaging Het
Slc13a4 T C 6: 35,247,290 (GRCm39) I577V possibly damaging Het
Slc20a2 T C 8: 23,030,447 (GRCm39) F168L probably benign Het
Slc25a1 A T 16: 17,745,108 (GRCm39) probably null Het
Slc5a12 A G 2: 110,471,242 (GRCm39) S495G probably benign Het
Smpdl3a A G 10: 57,677,028 (GRCm39) D42G possibly damaging Het
Spag16 G C 1: 70,420,459 (GRCm39) L482F probably damaging Het
Susd5 G A 9: 113,925,289 (GRCm39) G391R probably damaging Het
Sync G T 4: 129,187,618 (GRCm39) A217S Het
Tha1 T A 11: 117,759,512 (GRCm39) N326Y probably damaging Het
Tjp1 A T 7: 64,952,564 (GRCm39) F1590Y probably benign Het
Tle4 T C 19: 14,445,583 (GRCm39) N221S probably benign Het
Tln1 T C 4: 43,536,024 (GRCm39) T2054A probably damaging Het
Ttll4 A G 1: 74,718,949 (GRCm39) K267E probably benign Het
Usp32 C T 11: 84,913,118 (GRCm39) G930D probably damaging Het
Vmn2r81 T C 10: 79,104,028 (GRCm39) L217P possibly damaging Het
Wnt2 T A 6: 18,030,397 (GRCm39) probably benign Het
Zfp459 C T 13: 67,556,735 (GRCm39) S116N probably benign Het
Zfp981 C A 4: 146,622,410 (GRCm39) T445N possibly damaging Het
Other mutations in Vmn2r75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Vmn2r75 APN 7 85,797,240 (GRCm39) unclassified probably benign
IGL01287:Vmn2r75 APN 7 85,797,801 (GRCm39) missense probably damaging 0.97
IGL01318:Vmn2r75 APN 7 85,814,774 (GRCm39) missense probably benign 0.06
IGL01331:Vmn2r75 APN 7 85,820,870 (GRCm39) nonsense probably null
IGL01406:Vmn2r75 APN 7 85,812,500 (GRCm39) splice site probably benign
IGL01615:Vmn2r75 APN 7 85,797,681 (GRCm39) missense probably benign 0.03
IGL01657:Vmn2r75 APN 7 85,813,455 (GRCm39) missense probably damaging 1.00
IGL02237:Vmn2r75 APN 7 85,814,786 (GRCm39) missense possibly damaging 0.88
IGL02275:Vmn2r75 APN 7 85,814,348 (GRCm39) missense probably benign 0.04
IGL02307:Vmn2r75 APN 7 85,814,974 (GRCm39) missense probably benign 0.00
IGL03136:Vmn2r75 APN 7 85,797,911 (GRCm39) missense possibly damaging 0.89
IGL03160:Vmn2r75 APN 7 85,797,644 (GRCm39) missense probably damaging 1.00
IGL03244:Vmn2r75 APN 7 85,820,933 (GRCm39) unclassified probably benign
PIT4449001:Vmn2r75 UTSW 7 85,814,791 (GRCm39) missense probably damaging 1.00
R0049:Vmn2r75 UTSW 7 85,797,309 (GRCm39) nonsense probably null
R0049:Vmn2r75 UTSW 7 85,797,309 (GRCm39) nonsense probably null
R0083:Vmn2r75 UTSW 7 85,814,866 (GRCm39) missense probably benign 0.00
R0108:Vmn2r75 UTSW 7 85,814,866 (GRCm39) missense probably benign 0.00
R0276:Vmn2r75 UTSW 7 85,797,515 (GRCm39) missense probably benign 0.01
R0320:Vmn2r75 UTSW 7 85,814,288 (GRCm39) missense probably benign 0.36
R0471:Vmn2r75 UTSW 7 85,814,721 (GRCm39) missense probably benign 0.01
R0562:Vmn2r75 UTSW 7 85,797,449 (GRCm39) nonsense probably null
R0631:Vmn2r75 UTSW 7 85,812,478 (GRCm39) missense probably null 1.00
R0661:Vmn2r75 UTSW 7 85,814,866 (GRCm39) missense probably benign 0.00
R0811:Vmn2r75 UTSW 7 85,814,575 (GRCm39) missense probably benign 0.38
R0812:Vmn2r75 UTSW 7 85,814,575 (GRCm39) missense probably benign 0.38
R0891:Vmn2r75 UTSW 7 85,813,476 (GRCm39) missense possibly damaging 0.81
R1340:Vmn2r75 UTSW 7 85,797,798 (GRCm39) missense probably damaging 0.98
R1501:Vmn2r75 UTSW 7 85,814,850 (GRCm39) missense possibly damaging 0.85
R1760:Vmn2r75 UTSW 7 85,798,019 (GRCm39) missense probably damaging 1.00
R1970:Vmn2r75 UTSW 7 85,797,470 (GRCm39) missense probably damaging 1.00
R2060:Vmn2r75 UTSW 7 85,814,372 (GRCm39) missense probably benign 0.00
R2292:Vmn2r75 UTSW 7 85,798,144 (GRCm39) missense probably damaging 1.00
R3688:Vmn2r75 UTSW 7 85,797,629 (GRCm39) missense probably damaging 0.99
R3892:Vmn2r75 UTSW 7 85,813,494 (GRCm39) missense probably null 1.00
R4532:Vmn2r75 UTSW 7 85,797,349 (GRCm39) nonsense probably null
R4583:Vmn2r75 UTSW 7 85,813,290 (GRCm39) missense possibly damaging 0.81
R4592:Vmn2r75 UTSW 7 85,815,494 (GRCm39) missense probably benign 0.00
R4792:Vmn2r75 UTSW 7 85,812,378 (GRCm39) missense possibly damaging 0.46
R4859:Vmn2r75 UTSW 7 85,797,611 (GRCm39) missense probably benign 0.35
R4896:Vmn2r75 UTSW 7 85,820,787 (GRCm39) missense probably benign 0.01
R4943:Vmn2r75 UTSW 7 85,814,705 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r75 UTSW 7 85,815,375 (GRCm39) critical splice donor site probably null
R5048:Vmn2r75 UTSW 7 85,814,735 (GRCm39) missense possibly damaging 0.66
R5063:Vmn2r75 UTSW 7 85,813,372 (GRCm39) missense probably benign
R5156:Vmn2r75 UTSW 7 85,813,436 (GRCm39) missense possibly damaging 0.51
R5243:Vmn2r75 UTSW 7 85,813,447 (GRCm39) missense probably damaging 1.00
R5277:Vmn2r75 UTSW 7 85,815,500 (GRCm39) missense probably benign
R5574:Vmn2r75 UTSW 7 85,815,510 (GRCm39) missense probably benign 0.22
R5622:Vmn2r75 UTSW 7 85,797,702 (GRCm39) missense probably benign 0.15
R5680:Vmn2r75 UTSW 7 85,820,779 (GRCm39) missense probably benign 0.10
R5884:Vmn2r75 UTSW 7 85,814,578 (GRCm39) missense probably benign
R6021:Vmn2r75 UTSW 7 85,820,820 (GRCm39) missense probably benign 0.01
R6217:Vmn2r75 UTSW 7 85,815,375 (GRCm39) critical splice donor site probably benign
R6242:Vmn2r75 UTSW 7 85,814,592 (GRCm39) missense probably damaging 1.00
R6299:Vmn2r75 UTSW 7 85,814,482 (GRCm39) missense probably benign 0.12
R6441:Vmn2r75 UTSW 7 85,820,784 (GRCm39) missense probably damaging 0.99
R6495:Vmn2r75 UTSW 7 85,813,287 (GRCm39) missense probably benign 0.00
R6553:Vmn2r75 UTSW 7 85,813,453 (GRCm39) missense probably benign 0.28
R6670:Vmn2r75 UTSW 7 85,797,644 (GRCm39) missense probably damaging 1.00
R7078:Vmn2r75 UTSW 7 85,815,568 (GRCm39) missense probably damaging 1.00
R7164:Vmn2r75 UTSW 7 85,814,592 (GRCm39) missense probably damaging 1.00
R8411:Vmn2r75 UTSW 7 85,797,722 (GRCm39) missense probably damaging 1.00
R8507:Vmn2r75 UTSW 7 85,797,685 (GRCm39) nonsense probably null
R8559:Vmn2r75 UTSW 7 85,815,480 (GRCm39) missense possibly damaging 0.65
R8677:Vmn2r75 UTSW 7 85,814,410 (GRCm39) missense possibly damaging 0.86
R8708:Vmn2r75 UTSW 7 85,812,476 (GRCm39) missense probably damaging 0.99
R8778:Vmn2r75 UTSW 7 85,813,497 (GRCm39) missense probably benign 0.40
R8968:Vmn2r75 UTSW 7 85,820,765 (GRCm39) nonsense probably null
R9316:Vmn2r75 UTSW 7 85,797,313 (GRCm39) missense possibly damaging 0.63
R9363:Vmn2r75 UTSW 7 85,815,423 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TAGGGAATCATGCTACATCTTAAGG -3'
(R):5'- GTCTTTAGCACTGAATACTTCTGG -3'

Sequencing Primer
(F):5'- CTGTTGACCACTTGGAAG -3'
(R):5'- TGTGTAAGCCTAATTGAAACT -3'
Posted On 2022-01-20