Mutagenetix > Incidental Mutation

Incidental Mutation 'R3758:Bcat1'

271521

Institutional Source

Beutler Lab

Gene Symbol

Bcat1

Ensembl Gene

ENSMUSG00000030268

Gene Name

branched chain aminotransferase 1, cytosolic

Synonyms

Eca39, BCATc, Bcat-1

MMRRC Submission

040739-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R3758 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

144939561-145021883 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 144978598 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 208 (I208F)

Ref Sequence

ENSEMBL: ENSMUSP00000032402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032402] [ENSMUST00000048252] [ENSMUST00000111742] [ENSMUST00000123930] [ENSMUST00000149769] [ENSMUST00000204138]

AlphaFold

P24288

Predicted Effect

probably damaging
Transcript: ENSMUST00000032402
AA Change: I208F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032402
Gene: ENSMUSG00000030268
AA Change: I208F

Domain	Start	End	E-Value	Type
Pfam:Aminotran_4	160	410	1.3e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000048252
AA Change: I141F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039744
Gene: ENSMUSG00000030268
AA Change: I141F

Domain	Start	End	E-Value	Type
Pfam:Aminotran_4	111	354	5.9e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111742
AA Change: I141F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000107371
Gene: ENSMUSG00000030268
AA Change: I141F

Domain	Start	End	E-Value	Type
Pfam:Aminotran_4	111	354	1.7e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000123930
AA Change: I140F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000120180
Gene: ENSMUSG00000030268
AA Change: I140F

Domain	Start	End	E-Value	Type
PDB:2COJ\|B	2	224	1e-139	PDB
SCOP:d1ekfa_	21	224	1e-76	SMART
Blast:FN3	129	192	5e-7	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000136819

SMART Domains

Protein: ENSMUSP00000117708
Gene: ENSMUSG00000030268

Domain	Start	End	E-Value	Type
PDB:2COJ\|B	2	76	2e-45	PDB
SCOP:d1ekfa_	2	76	2e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145911

Predicted Effect

probably damaging
Transcript: ENSMUST00000149769
AA Change: I116F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000116091
Gene: ENSMUSG00000030268
AA Change: I116F

Domain	Start	End	E-Value	Type
PDB:2ABJ\|J	2	136	1e-78	PDB
SCOP:d1ekfa_	2	136	1e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000204138

SMART Domains

Protein: ENSMUSP00000144968
Gene: ENSMUSG00000030268

Domain	Start	End	E-Value	Type
Pfam:Aminotran_4	34	180	9.1e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154611

SMART Domains

Protein: ENSMUSP00000123137
Gene: ENSMUSG00000030268

Domain	Start	End	E-Value	Type
PDB:2COJ\|B	1	84	2e-46	PDB
SCOP:d1ekfa_	1	84	4e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155693

SMART Domains

Protein: ENSMUSP00000116565
Gene: ENSMUSG00000030268

Domain	Start	End	E-Value	Type
PDB:2COJ\|B	1	112	8e-64	PDB
SCOP:d1ekfa_	1	112	2e-39	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

93% (28/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal amino acid metabilism in T cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acat3	A	G	17: 13,146,354 (GRCm39)		probably benign	Het
Cage1	A	C	13: 38,209,705 (GRCm39)	F91V	possibly damaging	Het
Cd200r3	T	G	16: 44,784,991 (GRCm39)		probably null	Het
Coq8b	C	T	7: 26,941,652 (GRCm39)	Q246*	probably null	Het
Dmxl1	G	A	18: 50,068,384 (GRCm39)	G2719D	probably damaging	Het
Fbln2	T	C	6: 91,233,363 (GRCm39)	S616P	probably damaging	Het
Fkbp10	G	A	11: 100,313,451 (GRCm39)		probably null	Het
Gabra1	G	T	11: 42,066,763 (GRCm39)	D50E	probably benign	Het
H1f4	T	A	13: 23,806,240 (GRCm39)	K81*	probably null	Het
Hmgcs2	A	G	3: 98,198,406 (GRCm39)	N103S	probably damaging	Het
Htt	A	G	5: 35,053,314 (GRCm39)	H2549R	probably damaging	Het
Lrba	A	G	3: 86,683,356 (GRCm39)	E2726G	probably damaging	Het
Lrrc7	T	C	3: 157,869,602 (GRCm39)	N706D	probably damaging	Het
Mill1	G	A	7: 17,996,628 (GRCm39)		probably null	Het
Mtcl2	T	C	2: 156,862,558 (GRCm39)	N1457S	possibly damaging	Het
Nipa2	T	C	7: 55,585,689 (GRCm39)	Y102C	probably damaging	Het
Nmd3	T	A	3: 69,631,641 (GRCm39)	C32*	probably null	Het
Or11h6	A	G	14: 50,880,493 (GRCm39)	K252E	possibly damaging	Het
Or4a78	A	G	2: 89,497,916 (GRCm39)	F105L	probably benign	Het
Or52r1b	A	G	7: 102,691,177 (GRCm39)	S159G	probably benign	Het
Or6c207	T	C	10: 129,104,934 (GRCm39)	D86G	probably damaging	Het
Pcdhb7	A	G	18: 37,476,079 (GRCm39)	D405G	possibly damaging	Het
Ptprt	A	T	2: 161,653,950 (GRCm39)	L560Q	probably damaging	Het
Serpinb9b	A	G	13: 33,219,571 (GRCm39)	Y166C	probably damaging	Het
Sprr1a	T	G	3: 92,391,704 (GRCm39)	K99T	probably damaging	Het
Spsb4	A	G	9: 96,877,924 (GRCm39)	V133A	probably damaging	Het
Suz12	A	G	11: 79,915,768 (GRCm39)	T391A	probably benign	Het
Tor1aip2	A	G	1: 155,941,035 (GRCm39)	E447G	probably damaging	Het
Ube4a	G	A	9: 44,861,198 (GRCm39)		probably benign	Het
Wdfy4	A	C	14: 32,745,331 (GRCm39)	H2296Q	probably benign	Het

Other mutations in Bcat1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01065:Bcat1	APN	6	144,946,015 (GRCm39)	missense	possibly damaging	0.89
IGL01882:Bcat1	APN	6	144,950,135 (GRCm39)	missense	probably damaging	1.00
IGL02021:Bcat1	APN	6	144,993,015 (GRCm39)	splice site	probably benign
IGL02024:Bcat1	APN	6	144,978,564 (GRCm39)	missense	probably damaging	0.97
IGL02705:Bcat1	APN	6	144,964,914 (GRCm39)	splice site	probably benign
IGL02954:Bcat1	APN	6	144,964,945 (GRCm39)	missense	probably damaging	1.00
R0331:Bcat1	UTSW	6	144,993,040 (GRCm39)	missense	probably benign	0.17
R1592:Bcat1	UTSW	6	144,955,784 (GRCm39)	missense	probably benign	0.00
R1680:Bcat1	UTSW	6	144,985,354 (GRCm39)	missense	probably damaging	1.00
R2162:Bcat1	UTSW	6	144,955,834 (GRCm39)	missense	probably damaging	1.00
R2306:Bcat1	UTSW	6	144,953,379 (GRCm39)	missense	probably damaging	0.96
R3498:Bcat1	UTSW	6	144,965,068 (GRCm39)	missense	probably damaging	0.99
R3831:Bcat1	UTSW	6	144,955,834 (GRCm39)	missense	probably damaging	1.00
R3833:Bcat1	UTSW	6	144,955,834 (GRCm39)	missense	probably damaging	1.00
R4829:Bcat1	UTSW	6	144,961,201 (GRCm39)	missense	probably damaging	1.00
R5250:Bcat1	UTSW	6	144,993,165 (GRCm39)	critical splice donor site	probably null
R5338:Bcat1	UTSW	6	144,953,353 (GRCm39)	missense	possibly damaging	0.50
R5414:Bcat1	UTSW	6	144,961,173 (GRCm39)	critical splice donor site	probably null
R5679:Bcat1	UTSW	6	144,953,474 (GRCm39)	missense	probably damaging	1.00
R6566:Bcat1	UTSW	6	144,961,210 (GRCm39)	missense	probably damaging	1.00
R7015:Bcat1	UTSW	6	144,985,309 (GRCm39)	missense	probably damaging	0.99
R7255:Bcat1	UTSW	6	144,978,511 (GRCm39)	nonsense	probably null
R7606:Bcat1	UTSW	6	144,994,358 (GRCm39)	missense	probably benign	0.06
R8115:Bcat1	UTSW	6	144,955,819 (GRCm39)	missense	probably damaging	1.00
R9198:Bcat1	UTSW	6	144,985,222 (GRCm39)	missense	probably damaging	1.00
R9342:Bcat1	UTSW	6	144,994,332 (GRCm39)	missense	probably benign
R9588:Bcat1	UTSW	6	144,950,126 (GRCm39)	missense	probably benign	0.04
R9665:Bcat1	UTSW	6	144,994,488 (GRCm39)	missense	probably benign
RF004:Bcat1	UTSW	6	144,953,349 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTGACATCCACACACGTG -3'
(R):5'- CGATGTTTCATGTTAGGAAAGAGTG -3'

Sequencing Primer
(F):5'- CACACGTGGTGGCTCAC -3'
(R):5'- TGAATAAAAGCTGTTGAAGGAGCC -3'

Posted On

2015-03-18