Incidental Mutation 'R3796:Basp1'
ID 272775
Institutional Source Beutler Lab
Gene Symbol Basp1
Ensembl Gene ENSMUSG00000045763
Gene Name brain abundant, membrane attached signal protein 1
Synonyms 2610024P12Rik, CAP23, CAP-23, Ckap3
MMRRC Submission 040757-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3796 (G1)
Quality Score 206
Status Validated
Chromosome 15
Chromosomal Location 25363363-25413850 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to A at 25364398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058845] [ENSMUST00000228597]
AlphaFold Q91XV3
Predicted Effect unknown
Transcript: ENSMUST00000058845
AA Change: A200S
SMART Domains Protein: ENSMUSP00000053943
Gene: ENSMUSG00000045763
AA Change: A200S

DomainStartEndE-ValueType
Pfam:BASP1 2 226 5.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228597
Meta Mutation Damage Score 0.1509 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane bound protein with several transient phosphorylation sites and PEST motifs. Conservation of proteins with PEST sequences among different species supports their functional significance. PEST sequences typically occur in proteins with high turnover rates. Immunological characteristics of this protein are species specific. This protein also undergoes N-terminal myristoylation. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, hyperactivity, decreased body weight, and defects in neurite axon outgrowth, Schwann cell morphology, and brain ventricle size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 A G 7: 66,489,662 (GRCm39) probably null Het
Alpk3 C A 7: 80,742,501 (GRCm39) P773T probably benign Het
Alppl2 A G 1: 87,016,076 (GRCm39) probably null Het
Armh3 A G 19: 45,910,049 (GRCm39) probably benign Het
Clec14a G A 12: 58,314,695 (GRCm39) A309V probably benign Het
Clk2 A G 3: 89,082,996 (GRCm39) N424S probably benign Het
Cops7a C T 6: 124,936,795 (GRCm39) R252H probably damaging Het
Csmd2 C T 4: 128,411,388 (GRCm39) P2469S probably benign Het
Cwf19l1 A G 19: 44,103,006 (GRCm39) V403A probably damaging Het
Dnajc16 G T 4: 141,495,048 (GRCm39) D521E probably benign Het
Dnm2 T C 9: 21,416,783 (GRCm39) V772A probably benign Het
Dst G T 1: 34,220,996 (GRCm39) V2267F probably benign Het
Eif3d A G 15: 77,852,769 (GRCm39) F4S probably damaging Het
Fgfr1 G A 8: 26,062,453 (GRCm39) D663N probably damaging Het
Hmcn1 A G 1: 150,462,169 (GRCm39) Y5170H probably damaging Het
Kcna2 T A 3: 107,012,906 (GRCm39) L496I probably benign Het
Krt8 T C 15: 101,907,877 (GRCm39) I233V probably benign Het
Mfap1b A G 2: 121,304,386 (GRCm39) V3A probably benign Het
Phrf1 C T 7: 140,839,831 (GRCm39) R243* probably null Het
Plbd2 A T 5: 120,630,933 (GRCm39) I224N probably damaging Het
Rab19 T C 6: 39,360,975 (GRCm39) V41A probably benign Het
Rrm1 T A 7: 102,114,910 (GRCm39) probably null Het
Sacs T C 14: 61,443,570 (GRCm39) V1872A possibly damaging Het
Setd2 T C 9: 110,378,639 (GRCm39) V818A probably benign Het
Shprh C T 10: 11,054,501 (GRCm39) L1037F possibly damaging Het
Slc24a3 A G 2: 145,458,601 (GRCm39) D527G probably damaging Het
Slc27a6 T C 18: 58,731,823 (GRCm39) probably benign Het
Slc35g3 A G 11: 69,651,743 (GRCm39) F103L probably benign Het
Slc5a1 A G 5: 33,309,996 (GRCm39) D408G probably damaging Het
Spag6l A T 16: 16,580,916 (GRCm39) I477N probably damaging Het
Srgap1 A G 10: 121,883,037 (GRCm39) V21A probably benign Het
Trim7 A G 11: 48,736,497 (GRCm39) probably null Het
Trpa1 T C 1: 14,963,488 (GRCm39) N578S possibly damaging Het
Xdh T C 17: 74,214,653 (GRCm39) E764G probably damaging Het
Zfp518a G T 19: 40,903,754 (GRCm39) V1228F probably damaging Het
Other mutations in Basp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Basp1 APN 15 25,364,953 (GRCm39) missense unknown
R0573:Basp1 UTSW 15 25,364,948 (GRCm39) missense unknown
R3797:Basp1 UTSW 15 25,364,398 (GRCm39) unclassified probably benign
R3798:Basp1 UTSW 15 25,364,398 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGGCAATACATATCCTCACTTCC -3'
(R):5'- AGGGCTACAATGTGAACGAC -3'

Sequencing Primer
(F):5'- TCCTCACTTCCAATTTGAAACAAG -3'
(R):5'- ACGCCACCGAGGTCAAG -3'
Posted On 2015-03-25