Incidental Mutation 'R3796:Basp1'
ID272775
Institutional Source Beutler Lab
Gene Symbol Basp1
Ensembl Gene ENSMUSG00000045763
Gene Namebrain abundant, membrane attached signal protein 1
SynonymsCkap3, CAP-23, 2610024P12Rik, CAP23
MMRRC Submission 040757-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3796 (G1)
Quality Score206
Status Validated
Chromosome15
Chromosomal Location25363277-25413764 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 25364312 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058845] [ENSMUST00000228597]
Predicted Effect unknown
Transcript: ENSMUST00000058845
AA Change: A200S
SMART Domains Protein: ENSMUSP00000053943
Gene: ENSMUSG00000045763
AA Change: A200S

DomainStartEndE-ValueType
Pfam:BASP1 2 226 5.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228597
Meta Mutation Damage Score 0.1509 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane bound protein with several transient phosphorylation sites and PEST motifs. Conservation of proteins with PEST sequences among different species supports their functional significance. PEST sequences typically occur in proteins with high turnover rates. Immunological characteristics of this protein are species specific. This protein also undergoes N-terminal myristoylation. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, hyperactivity, decreased body weight, and defects in neurite axon outgrowth, Schwann cell morphology, and brain ventricle size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,921,610 probably benign Het
Adamts17 A G 7: 66,839,914 probably null Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Alppl2 A G 1: 87,088,354 probably null Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clk2 A G 3: 89,175,689 N424S probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Dnajc16 G T 4: 141,767,737 D521E probably benign Het
Dnm2 T C 9: 21,505,487 V772A probably benign Het
Dst G T 1: 34,181,915 V2267F probably benign Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Hmcn1 A G 1: 150,586,418 Y5170H probably damaging Het
Kcna2 T A 3: 107,105,590 L496I probably benign Het
Krt8 T C 15: 101,999,442 I233V probably benign Het
Mfap1b A G 2: 121,473,905 V3A probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Plbd2 A T 5: 120,492,868 I224N probably damaging Het
Rab19 T C 6: 39,384,041 V41A probably benign Het
Rrm1 T A 7: 102,465,703 probably null Het
Sacs T C 14: 61,206,121 V1872A possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Shprh C T 10: 11,178,757 L1037F possibly damaging Het
Slc24a3 A G 2: 145,616,681 D527G probably damaging Het
Slc27a6 T C 18: 58,598,751 probably benign Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Slc5a1 A G 5: 33,152,652 D408G probably damaging Het
Spag6l A T 16: 16,763,052 I477N probably damaging Het
Srgap1 A G 10: 122,047,132 V21A probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Trpa1 T C 1: 14,893,264 N578S possibly damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Zfp518a G T 19: 40,915,310 V1228F probably damaging Het
Other mutations in Basp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Basp1 APN 15 25364867 missense unknown
R0573:Basp1 UTSW 15 25364862 missense unknown
R3797:Basp1 UTSW 15 25364312 unclassified probably benign
R3798:Basp1 UTSW 15 25364312 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGGCAATACATATCCTCACTTCC -3'
(R):5'- AGGGCTACAATGTGAACGAC -3'

Sequencing Primer
(F):5'- TCCTCACTTCCAATTTGAAACAAG -3'
(R):5'- ACGCCACCGAGGTCAAG -3'
Posted On2015-03-25