Incidental Mutation 'R0375:Npm3'
ID30724
Institutional Source Beutler Lab
Gene Symbol Npm3
Ensembl Gene ENSMUSG00000056209
Gene Namenucleoplasmin 3
SynonymsNub1
MMRRC Submission 038581-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0375 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location45747734-45749591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45748229 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 157 (E157G)
Ref Sequence ENSEMBL: ENSMUSP00000069578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026243] [ENSMUST00000070215]
Predicted Effect probably benign
Transcript: ENSMUST00000026243
SMART Domains Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAGidase 62 361 2.5e-84 PFAM
low complexity region 453 458 N/A INTRINSIC
PDB:4BMH|A 700 915 1e-13 PDB
SCOP:d1cjwa_ 715 916 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000070215
AA Change: E157G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069578
Gene: ENSMUSG00000056209
AA Change: E157G

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 17 32 N/A INTRINSIC
Pfam:Nucleoplasmin 35 170 2.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144165
Meta Mutation Damage Score 0.1073 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is related to the nuclear chaperone phosphoproteins, nucleoplasmin and nucleophosmin. This protein is strongly expressed in diverse cell types where it localizes primarily to the nucleus. Based on its similarity to nucleoplasmin and nucleophosmin, this protein likely functions as a molecular chaperone in the cell nucleus. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,046,252 T4707I probably damaging Het
5730522E02Rik T A 11: 25,769,092 Y17F unknown Het
Aars2 A G 17: 45,514,550 D313G probably damaging Het
Abca9 A T 11: 110,115,447 D1277E probably benign Het
Adgrl1 G T 8: 83,934,901 A981S probably damaging Het
Aff3 T G 1: 38,204,940 K917Q possibly damaging Het
BC049715 A T 6: 136,839,996 H78L probably benign Het
Cacna1g C A 11: 94,411,054 A2027S possibly damaging Het
Camk1g G A 1: 193,356,401 probably benign Het
Carf T C 1: 60,144,002 V386A probably damaging Het
Cd46 A G 1: 195,086,164 S82P probably benign Het
Clic5 A G 17: 44,270,623 E180G possibly damaging Het
Col27a1 A G 4: 63,225,661 T529A probably benign Het
Col7a1 C T 9: 108,980,237 R2627C unknown Het
Cuzd1 G A 7: 131,311,908 probably benign Het
Cwc27 T C 13: 104,807,823 D50G possibly damaging Het
Dhx38 A G 8: 109,555,181 V735A possibly damaging Het
Dhx57 T G 17: 80,258,121 E834A probably damaging Het
Dsg4 A G 18: 20,470,879 D801G probably damaging Het
Dtx1 T C 5: 120,681,399 E578G probably damaging Het
F830016B08Rik A T 18: 60,300,193 H116L probably damaging Het
Fam208b A G 13: 3,596,842 V61A possibly damaging Het
Fbxw18 T C 9: 109,688,839 I360V possibly damaging Het
Fignl2 G A 15: 101,054,093 P103S probably benign Het
Frmpd1 A G 4: 45,284,196 T1006A probably benign Het
Ggnbp2 G T 11: 84,836,374 C545* probably null Het
Gm3336 A G 8: 70,718,645 probably benign Het
Gpr37 T C 6: 25,669,291 N518S probably benign Het
Hbs1l T A 10: 21,342,541 D312E possibly damaging Het
Hoxd10 C A 2: 74,692,720 S247R probably benign Het
Ifnb1 A T 4: 88,522,744 F11I probably benign Het
Marf1 T C 16: 14,151,320 probably benign Het
Myo1f T A 17: 33,601,956 V879E probably benign Het
Naip1 A G 13: 100,409,148 F1291L probably benign Het
Nckap1l A G 15: 103,474,159 E529G probably damaging Het
Olfr1200 T A 2: 88,767,641 T225S possibly damaging Het
Olfr1240 G T 2: 89,439,396 N294K probably benign Het
Olfr248 A G 1: 174,391,209 T47A probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Ppp6r1 A G 7: 4,633,287 V768A probably benign Het
Prrc1 A G 18: 57,362,492 T14A probably damaging Het
Ranbp2 T C 10: 58,477,283 L1275P probably damaging Het
Rnf214 C A 9: 45,899,823 V181F probably damaging Het
Ror2 T C 13: 53,132,004 N58S probably damaging Het
Selplg G A 5: 113,820,008 T79I probably damaging Het
Setd1b G A 5: 123,157,437 G1023S unknown Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Skint5 A G 4: 113,705,596 V803A unknown Het
Slc25a46 T C 18: 31,583,266 I394M possibly damaging Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Spag17 C A 3: 100,027,590 T704K probably benign Het
Tas2r144 T A 6: 42,216,124 M266K possibly damaging Het
Tbc1d31 T A 15: 57,955,350 L783H probably benign Het
Tbck C A 3: 132,751,232 probably benign Het
Vcan A G 13: 89,691,275 V2050A probably damaging Het
Vmn1r70 T A 7: 10,634,060 N158K probably damaging Het
Vmn2r103 T A 17: 19,792,859 Y81N probably benign Het
Vmn2r103 A G 17: 19,793,464 T173A probably benign Het
Ylpm1 T G 12: 85,014,980 S552A unknown Het
Zdhhc17 A T 10: 110,982,106 Y58* probably null Het
Other mutations in Npm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02208:Npm3 APN 19 45748860 missense probably benign 0.33
R0329:Npm3 UTSW 19 45749526 missense probably benign 0.06
R4044:Npm3 UTSW 19 45748253 missense possibly damaging 0.90
R5810:Npm3 UTSW 19 45748205 missense possibly damaging 0.74
R7049:Npm3 UTSW 19 45749555 start codon destroyed probably null 0.02
R8032:Npm3 UTSW 19 45748243 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAAGTCAGAGTCTTCCTCCTCACC -3'
(R):5'- GTGTGTCCTGCATCTCAGGCTATG -3'

Sequencing Primer
(F):5'- TCACCTGCTGCCCCTAAAC -3'
(R):5'- CTGGGAACTTGCTGTACCCTG -3'
Posted On2013-04-24