Incidental Mutation 'R0375:Cwc27'
ID30709
Institutional Source Beutler Lab
Gene Symbol Cwc27
Ensembl Gene ENSMUSG00000021715
Gene NameCWC27 spliceosome-associated protein
Synonyms3110009E13Rik, NY-CO-10, Sdccag10
MMRRC Submission 038581-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0375 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location104631140-104817142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104807823 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 50 (D50G)
Ref Sequence ENSEMBL: ENSMUSP00000022228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022228] [ENSMUST00000154165]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022228
AA Change: D50G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022228
Gene: ENSMUSG00000021715
AA Change: D50G

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 166 3.4e-47 PFAM
low complexity region 176 197 N/A INTRINSIC
low complexity region 209 217 N/A INTRINSIC
coiled coil region 309 341 N/A INTRINSIC
low complexity region 452 469 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145661
Predicted Effect probably benign
Transcript: ENSMUST00000154165
AA Change: D50G

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119076
Gene: ENSMUSG00000021715
AA Change: D50G

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 82 1.3e-24 PFAM
Meta Mutation Damage Score 0.6415 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit reduced viability. Surviors after birth show signs of growth retardation and retinal depigmentation, along with numerous neurological, immunological, and blood chemistry abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,046,252 T4707I probably damaging Het
5730522E02Rik T A 11: 25,769,092 Y17F unknown Het
Aars2 A G 17: 45,514,550 D313G probably damaging Het
Abca9 A T 11: 110,115,447 D1277E probably benign Het
Adgrl1 G T 8: 83,934,901 A981S probably damaging Het
Aff3 T G 1: 38,204,940 K917Q possibly damaging Het
BC049715 A T 6: 136,839,996 H78L probably benign Het
Cacna1g C A 11: 94,411,054 A2027S possibly damaging Het
Camk1g G A 1: 193,356,401 probably benign Het
Carf T C 1: 60,144,002 V386A probably damaging Het
Cd46 A G 1: 195,086,164 S82P probably benign Het
Clic5 A G 17: 44,270,623 E180G possibly damaging Het
Col27a1 A G 4: 63,225,661 T529A probably benign Het
Col7a1 C T 9: 108,980,237 R2627C unknown Het
Cuzd1 G A 7: 131,311,908 probably benign Het
Dhx38 A G 8: 109,555,181 V735A possibly damaging Het
Dhx57 T G 17: 80,258,121 E834A probably damaging Het
Dsg4 A G 18: 20,470,879 D801G probably damaging Het
Dtx1 T C 5: 120,681,399 E578G probably damaging Het
F830016B08Rik A T 18: 60,300,193 H116L probably damaging Het
Fam208b A G 13: 3,596,842 V61A possibly damaging Het
Fbxw18 T C 9: 109,688,839 I360V possibly damaging Het
Fignl2 G A 15: 101,054,093 P103S probably benign Het
Frmpd1 A G 4: 45,284,196 T1006A probably benign Het
Ggnbp2 G T 11: 84,836,374 C545* probably null Het
Gm3336 A G 8: 70,718,645 probably benign Het
Gpr37 T C 6: 25,669,291 N518S probably benign Het
Hbs1l T A 10: 21,342,541 D312E possibly damaging Het
Hoxd10 C A 2: 74,692,720 S247R probably benign Het
Ifnb1 A T 4: 88,522,744 F11I probably benign Het
Marf1 T C 16: 14,151,320 probably benign Het
Myo1f T A 17: 33,601,956 V879E probably benign Het
Naip1 A G 13: 100,409,148 F1291L probably benign Het
Nckap1l A G 15: 103,474,159 E529G probably damaging Het
Npm3 T C 19: 45,748,229 E157G probably damaging Het
Olfr1200 T A 2: 88,767,641 T225S possibly damaging Het
Olfr1240 G T 2: 89,439,396 N294K probably benign Het
Olfr248 A G 1: 174,391,209 T47A probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Ppp6r1 A G 7: 4,633,287 V768A probably benign Het
Prrc1 A G 18: 57,362,492 T14A probably damaging Het
Ranbp2 T C 10: 58,477,283 L1275P probably damaging Het
Rnf214 C A 9: 45,899,823 V181F probably damaging Het
Ror2 T C 13: 53,132,004 N58S probably damaging Het
Selplg G A 5: 113,820,008 T79I probably damaging Het
Setd1b G A 5: 123,157,437 G1023S unknown Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Skint5 A G 4: 113,705,596 V803A unknown Het
Slc25a46 T C 18: 31,583,266 I394M possibly damaging Het
Snrnp27 A T 6: 86,680,953 I101K possibly damaging Het
Spag17 C A 3: 100,027,590 T704K probably benign Het
Tas2r144 T A 6: 42,216,124 M266K possibly damaging Het
Tbc1d31 T A 15: 57,955,350 L783H probably benign Het
Tbck C A 3: 132,751,232 probably benign Het
Vcan A G 13: 89,691,275 V2050A probably damaging Het
Vmn1r70 T A 7: 10,634,060 N158K probably damaging Het
Vmn2r103 T A 17: 19,792,859 Y81N probably benign Het
Vmn2r103 A G 17: 19,793,464 T173A probably benign Het
Ylpm1 T G 12: 85,014,980 S552A unknown Het
Zdhhc17 A T 10: 110,982,106 Y58* probably null Het
Other mutations in Cwc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01955:Cwc27 APN 13 104807737 missense probably damaging 1.00
IGL02240:Cwc27 APN 13 104806643 missense probably damaging 0.97
IGL02398:Cwc27 APN 13 104804254 missense possibly damaging 0.82
IGL02620:Cwc27 APN 13 104802206 splice site probably benign
IGL03213:Cwc27 APN 13 104796403 splice site probably benign
pam1 UTSW 13 104661357 nonsense probably null
R0483:Cwc27 UTSW 13 104811216 critical splice donor site probably null
R0534:Cwc27 UTSW 13 104631616 missense unknown
R0550:Cwc27 UTSW 13 104804949 missense probably damaging 1.00
R0562:Cwc27 UTSW 13 104661357 nonsense probably null
R0563:Cwc27 UTSW 13 104661357 nonsense probably null
R0564:Cwc27 UTSW 13 104661357 nonsense probably null
R0972:Cwc27 UTSW 13 104661357 nonsense probably null
R1536:Cwc27 UTSW 13 104797306 missense probably damaging 1.00
R1546:Cwc27 UTSW 13 104802185 missense probably damaging 1.00
R1587:Cwc27 UTSW 13 104792637 missense probably benign 0.00
R1934:Cwc27 UTSW 13 104631676 missense probably benign 0.28
R2159:Cwc27 UTSW 13 104804329 missense probably damaging 0.98
R2249:Cwc27 UTSW 13 104631622 missense unknown
R2252:Cwc27 UTSW 13 104631729 missense probably damaging 1.00
R2394:Cwc27 UTSW 13 104796434 missense probably benign 0.01
R2698:Cwc27 UTSW 13 104806751 missense probably damaging 0.99
R3899:Cwc27 UTSW 13 104792515 nonsense probably null
R5121:Cwc27 UTSW 13 104804353 missense probably damaging 1.00
R6317:Cwc27 UTSW 13 104804261 nonsense probably null
R6763:Cwc27 UTSW 13 104811301 missense probably damaging 1.00
R7187:Cwc27 UTSW 13 104661392 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGACACGATCACTTTTGAAGAAGC -3'
(R):5'- GAGACTGCACAGACAGTGCTAGAAC -3'

Sequencing Primer
(F):5'- GATCACTTTTGAAGAAGCGTTGC -3'
(R):5'- cagttttcccagttttgatagcc -3'
Posted On2013-04-24