Incidental Mutation 'R0375:Ylpm1'
ID30704
Institutional Source Beutler Lab
Gene Symbol Ylpm1
Ensembl Gene ENSMUSG00000021244
Gene NameYLP motif containing 1
SynonymsZAP, A930013E17Rik, Zap3
MMRRC Submission 038581-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0375 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84996321-85070515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85014980 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 552 (S552A)
Ref Sequence ENSEMBL: ENSMUSP00000128962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021670] [ENSMUST00000101202] [ENSMUST00000164558] [ENSMUST00000168977]
Predicted Effect unknown
Transcript: ENSMUST00000021670
AA Change: S552A
SMART Domains Protein: ENSMUSP00000021670
Gene: ENSMUSG00000021244
AA Change: S552A

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
internal_repeat_1 771 840 4.03e-5 PROSPERO
low complexity region 841 854 N/A INTRINSIC
low complexity region 966 972 N/A INTRINSIC
internal_repeat_1 1062 1124 4.03e-5 PROSPERO
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1326 1338 N/A INTRINSIC
low complexity region 1339 1353 N/A INTRINSIC
low complexity region 1408 1425 N/A INTRINSIC
coiled coil region 1447 1474 N/A INTRINSIC
low complexity region 1494 1517 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1557 N/A INTRINSIC
low complexity region 1598 1630 N/A INTRINSIC
low complexity region 1678 1694 N/A INTRINSIC
low complexity region 1705 1717 N/A INTRINSIC
low complexity region 1720 1736 N/A INTRINSIC
low complexity region 1797 1808 N/A INTRINSIC
Pfam:AAA_33 1829 1990 7.8e-11 PFAM
coiled coil region 1995 2032 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000101202
AA Change: S505A
SMART Domains Protein: ENSMUSP00000098763
Gene: ENSMUSG00000021244
AA Change: S505A

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 206 N/A INTRINSIC
low complexity region 294 335 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
low complexity region 375 388 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 491 607 N/A INTRINSIC
low complexity region 641 649 N/A INTRINSIC
low complexity region 741 764 N/A INTRINSIC
low complexity region 765 779 N/A INTRINSIC
low complexity region 783 804 N/A INTRINSIC
low complexity region 845 877 N/A INTRINSIC
low complexity region 925 941 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 967 983 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
Pfam:AAA_33 1076 1265 4.9e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000164558
AA Change: S94A
SMART Domains Protein: ENSMUSP00000126347
Gene: ENSMUSG00000021244
AA Change: S94A

DomainStartEndE-ValueType
low complexity region 80 196 N/A INTRINSIC
low complexity region 230 238 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 508 514 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
coiled coil region 989 1016 N/A INTRINSIC
low complexity region 1036 1059 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1078 1099 N/A INTRINSIC
low complexity region 1140 1172 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
low complexity region 1262 1278 N/A INTRINSIC
low complexity region 1339 1350 N/A INTRINSIC
Pfam:AAA_33 1371 1559 5.2e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168977
AA Change: S552A
SMART Domains Protein: ENSMUSP00000128962
Gene: ENSMUSG00000021244
AA Change: S552A

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 788 811 N/A INTRINSIC
low complexity region 812 826 N/A INTRINSIC
low complexity region 830 851 N/A INTRINSIC
low complexity region 892 924 N/A INTRINSIC
low complexity region 972 988 N/A INTRINSIC
low complexity region 999 1011 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:AAA_33 1123 1311 4.5e-11 PFAM
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,046,252 T4707I probably damaging Het
5730522E02Rik T A 11: 25,769,092 Y17F unknown Het
Aars2 A G 17: 45,514,550 D313G probably damaging Het
Abca9 A T 11: 110,115,447 D1277E probably benign Het
Adgrl1 G T 8: 83,934,901 A981S probably damaging Het
Aff3 T G 1: 38,204,940 K917Q possibly damaging Het
BC049715 A T 6: 136,839,996 H78L probably benign Het
Cacna1g C A 11: 94,411,054 A2027S possibly damaging Het
Camk1g G A 1: 193,356,401 probably benign Het
Carf T C 1: 60,144,002 V386A probably damaging Het
Cd46 A G 1: 195,086,164 S82P probably benign Het
Clic5 A G 17: 44,270,623 E180G possibly damaging Het
Col27a1 A G 4: 63,225,661 T529A probably benign Het
Col7a1 C T 9: 108,980,237 R2627C unknown Het
Cuzd1 G A 7: 131,311,908 probably benign Het
Cwc27 T C 13: 104,807,823 D50G possibly damaging Het
Dhx38 A G 8: 109,555,181 V735A possibly damaging Het
Dhx57 T G 17: 80,258,121 E834A probably damaging Het
Dsg4 A G 18: 20,470,879 D801G probably damaging Het
Dtx1 T C 5: 120,681,399 E578G probably damaging Het
F830016B08Rik A T 18: 60,300,193 H116L probably damaging Het
Fam208b A G 13: 3,596,842 V61A possibly damaging Het
Fbxw18 T C 9: 109,688,839 I360V possibly damaging Het
Fignl2 G A 15: 101,054,093 P103S probably benign Het
Frmpd1 A G 4: 45,284,196 T1006A probably benign Het
Ggnbp2 G T 11: 84,836,374 C545* probably null Het
Gm3336 A G 8: 70,718,645 probably benign Het
Gpr37 T C 6: 25,669,291 N518S probably benign Het
Hbs1l T A 10: 21,342,541 D312E possibly damaging Het
Hoxd10 C A 2: 74,692,720 S247R probably benign Het
Ifnb1 A T 4: 88,522,744 F11I probably benign Het
Marf1 T C 16: 14,151,320 probably benign Het
Myo1f T A 17: 33,601,956 V879E probably benign Het
Naip1 A G 13: 100,409,148 F1291L probably benign Het
Nckap1l A G 15: 103,474,159 E529G probably damaging Het
Npm3 T C 19: 45,748,229 E157G probably damaging Het
Olfr1200 T A 2: 88,767,641 T225S possibly damaging Het
Olfr1240 G T 2: 89,439,396 N294K probably benign Het
Olfr248 A G 1: 174,391,209 T47A probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Ppp6r1 A G 7: 4,633,287 V768A probably benign Het
Prrc1 A G 18: 57,362,492 T14A probably damaging Het
Ranbp2 T C 10: 58,477,283 L1275P probably damaging Het
Rnf214 C A 9: 45,899,823 V181F probably damaging Het
Ror2 T C 13: 53,132,004 N58S probably damaging Het
Selplg G A 5: 113,820,008 T79I probably damaging Het
Setd1b G A 5: 123,157,437 G1023S unknown Het
Sf3b2 C T 19: 5,274,824 D845N probably damaging Het
Skint5 A G 4: 113,705,596 V803A unknown Het
Slc25a46 T C 18: 31,583,266 I394M possibly damaging Het
Snrnp27 A T 6: 86,680,953 I101K probably damaging Het
Spag17 C A 3: 100,027,590 T704K probably benign Het
Tas2r144 T A 6: 42,216,124 M266K possibly damaging Het
Tbc1d31 T A 15: 57,955,350 L783H probably benign Het
Tbck C A 3: 132,751,232 probably benign Het
Vcan A G 13: 89,691,275 V2050A probably damaging Het
Vmn1r70 T A 7: 10,634,060 N158K probably damaging Het
Vmn2r103 T A 17: 19,792,859 Y81N probably benign Het
Vmn2r103 A G 17: 19,793,464 T173A probably benign Het
Zdhhc17 A T 10: 110,982,106 Y58* probably null Het
Other mutations in Ylpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ylpm1 APN 12 85028954 missense possibly damaging 0.93
IGL00809:Ylpm1 APN 12 85049194 missense probably damaging 0.99
IGL01508:Ylpm1 APN 12 85015455 missense possibly damaging 0.74
IGL02199:Ylpm1 APN 12 85034005 nonsense probably null
IGL02392:Ylpm1 APN 12 85014957 missense unknown
IGL02455:Ylpm1 APN 12 85030263 missense probably damaging 1.00
IGL02506:Ylpm1 APN 12 85049191 missense probably damaging 1.00
IGL03102:Ylpm1 APN 12 85049258 splice site probably benign
I1329:Ylpm1 UTSW 12 85040880 missense probably damaging 1.00
IGL02799:Ylpm1 UTSW 12 85044484 missense probably damaging 1.00
R0010:Ylpm1 UTSW 12 85029026 missense probably damaging 0.97
R0090:Ylpm1 UTSW 12 85029040 intron probably benign
R0149:Ylpm1 UTSW 12 85028838 missense probably damaging 0.99
R0226:Ylpm1 UTSW 12 85049737 missense probably benign 0.21
R0378:Ylpm1 UTSW 12 84997076 intron probably benign
R0507:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R0742:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R1350:Ylpm1 UTSW 12 85014082 unclassified probably benign
R1452:Ylpm1 UTSW 12 85030383 missense possibly damaging 0.94
R1500:Ylpm1 UTSW 12 85014996 missense unknown
R1837:Ylpm1 UTSW 12 85029333 missense possibly damaging 0.92
R1945:Ylpm1 UTSW 12 85015418 missense probably damaging 0.98
R1971:Ylpm1 UTSW 12 85040786 missense probably damaging 1.00
R2211:Ylpm1 UTSW 12 85044378 nonsense probably null
R2213:Ylpm1 UTSW 12 85069718 missense probably benign 0.25
R2269:Ylpm1 UTSW 12 85015050 missense unknown
R2300:Ylpm1 UTSW 12 85060319 splice site probably null
R2439:Ylpm1 UTSW 12 85014117 unclassified probably benign
R2497:Ylpm1 UTSW 12 84996761 missense probably damaging 0.98
R2890:Ylpm1 UTSW 12 85029813 missense probably damaging 0.99
R3111:Ylpm1 UTSW 12 85029371 missense probably damaging 0.98
R3436:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R3437:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R4156:Ylpm1 UTSW 12 85057403 intron probably benign
R4157:Ylpm1 UTSW 12 85057403 intron probably benign
R4959:Ylpm1 UTSW 12 85049945 missense probably damaging 1.00
R5014:Ylpm1 UTSW 12 85014749 missense unknown
R5039:Ylpm1 UTSW 12 85015493 missense probably damaging 0.98
R5039:Ylpm1 UTSW 12 85042239 missense probably damaging 1.00
R5084:Ylpm1 UTSW 12 85029321 missense probably damaging 0.99
R5325:Ylpm1 UTSW 12 85013961 unclassified probably benign
R5378:Ylpm1 UTSW 12 85030255 missense probably damaging 0.99
R5428:Ylpm1 UTSW 12 85030229 missense probably benign 0.04
R5467:Ylpm1 UTSW 12 84996859 missense unknown
R5605:Ylpm1 UTSW 12 85028853 missense probably damaging 1.00
R5614:Ylpm1 UTSW 12 85064944 intron probably benign
R5748:Ylpm1 UTSW 12 85060251 splice site probably null
R5860:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5861:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5881:Ylpm1 UTSW 12 85042125 missense probably damaging 1.00
R5909:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5912:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5915:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R6000:Ylpm1 UTSW 12 84997256 missense unknown
R6004:Ylpm1 UTSW 12 85029084 missense possibly damaging 0.78
R6007:Ylpm1 UTSW 12 85029290 missense probably benign 0.33
R6053:Ylpm1 UTSW 12 84996503 missense possibly damaging 0.72
R6104:Ylpm1 UTSW 12 85029630 missense probably benign 0.00
R6197:Ylpm1 UTSW 12 85042179 missense probably damaging 1.00
R6293:Ylpm1 UTSW 12 85015277 missense unknown
R6297:Ylpm1 UTSW 12 85015277 missense unknown
R6305:Ylpm1 UTSW 12 85030545 missense probably damaging 1.00
R6379:Ylpm1 UTSW 12 85030800 missense probably damaging 1.00
R6465:Ylpm1 UTSW 12 85049802 missense probably damaging 1.00
R6608:Ylpm1 UTSW 12 85015277 missense unknown
R6609:Ylpm1 UTSW 12 85015277 missense unknown
R6737:Ylpm1 UTSW 12 85030846 missense probably damaging 0.98
R6794:Ylpm1 UTSW 12 84996881 missense unknown
R7383:Ylpm1 UTSW 12 85044468 missense possibly damaging 0.93
R7514:Ylpm1 UTSW 12 85030494 missense possibly damaging 0.94
Z1088:Ylpm1 UTSW 12 85030155 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCAGCAGCAACAGTTTCAACATC -3'
(R):5'- TAACTGAGGAGGCATCCCTTGTGG -3'

Sequencing Primer
(F):5'- ACATCTCTTTCAAGACTGGGAGC -3'
(R):5'- TGGTGACCCTGCTGAAGAG -3'
Posted On2013-04-24