Incidental Mutation 'R5810:Npm3'
ID447499
Institutional Source Beutler Lab
Gene Symbol Npm3
Ensembl Gene ENSMUSG00000056209
Gene Namenucleoplasmin 3
SynonymsNub1
MMRRC Submission 043395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5810 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location45747734-45749591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45748205 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 165 (I165T)
Ref Sequence ENSEMBL: ENSMUSP00000069578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026243] [ENSMUST00000070215]
Predicted Effect probably benign
Transcript: ENSMUST00000026243
SMART Domains Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAGidase 62 361 2.5e-84 PFAM
low complexity region 453 458 N/A INTRINSIC
PDB:4BMH|A 700 915 1e-13 PDB
SCOP:d1cjwa_ 715 916 1e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000070215
AA Change: I165T

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069578
Gene: ENSMUSG00000056209
AA Change: I165T

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 17 32 N/A INTRINSIC
Pfam:Nucleoplasmin 35 170 2.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144165
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is related to the nuclear chaperone phosphoproteins, nucleoplasmin and nucleophosmin. This protein is strongly expressed in diverse cell types where it localizes primarily to the nucleus. Based on its similarity to nucleoplasmin and nucleophosmin, this protein likely functions as a molecular chaperone in the cell nucleus. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,079,631 F866L probably benign Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Actl11 C T 9: 107,929,221 P248S probably benign Het
Actr3 A G 1: 125,416,379 probably benign Het
Baz1a G A 12: 54,927,715 probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bpifa5 G A 2: 154,163,718 probably null Het
Car13 A C 3: 14,641,768 probably null Het
Ceacam18 A T 7: 43,636,958 H85L probably benign Het
Cnnm3 A G 1: 36,525,199 E704G probably benign Het
Cyp4f14 T A 17: 32,906,098 I450F possibly damaging Het
Ddhd1 G T 14: 45,602,707 T710N probably damaging Het
Ddx60 C T 8: 62,012,388 Q1360* probably null Het
Dlg5 A G 14: 24,146,254 V1625A probably damaging Het
Dst G A 1: 34,183,040 probably benign Het
Dyrk2 G T 10: 118,860,340 H338N probably benign Het
Epb41l1 A T 2: 156,499,655 I187F probably damaging Het
Esd A G 14: 74,745,611 D221G probably damaging Het
Fam53b T A 7: 132,760,164 N45I probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fryl A T 5: 73,090,755 D1006E probably benign Het
Gli3 T C 13: 15,644,309 V232A probably damaging Het
Gm12666 A T 4: 92,191,583 probably null Het
Gm28308 C A 6: 52,213,216 probably benign Het
Gpatch1 G A 7: 35,295,371 A490V probably benign Het
Hoxa7 T C 6: 52,216,024 D128G probably benign Het
Igdcc4 A G 9: 65,128,695 T751A probably damaging Het
Igsf10 G A 3: 59,319,071 L2394F probably damaging Het
Il15ra A G 2: 11,733,252 probably null Het
Il17re C T 6: 113,469,596 A436V probably damaging Het
Krtap19-2 T C 16: 88,874,236 probably benign Het
Lgals12 T C 19: 7,606,720 D4G probably benign Het
Liph A T 16: 21,968,110 L252Q probably damaging Het
Mtg1 T A 7: 140,145,985 probably null Het
Myo18b A G 5: 112,834,450 L1139P probably damaging Het
Ninl T C 2: 150,950,168 R812G probably benign Het
Olfr381 G T 11: 73,486,095 S243* probably null Het
Osbpl9 A G 4: 109,086,374 V231A probably benign Het
Pgam2 T C 11: 5,803,417 H91R possibly damaging Het
Pkhd1 A G 1: 20,200,673 W3219R probably benign Het
Procr A G 2: 155,751,407 K4E possibly damaging Het
Slc22a16 C T 10: 40,595,318 T495I possibly damaging Het
Slc22a6 A G 19: 8,623,858 K425E probably damaging Het
Slco6c1 A T 1: 97,075,873 C500S probably damaging Het
Snrpd2 G T 7: 19,152,522 V77F probably benign Het
Sp100 G A 1: 85,665,285 G145D probably benign Het
Spg7 G A 8: 123,094,569 E678K possibly damaging Het
Ssh1 T C 5: 113,946,566 K538E probably benign Het
Sspo C T 6: 48,483,898 R3356W probably benign Het
Stx1a G T 5: 135,049,078 V255F probably damaging Het
Tbc1d13 C A 2: 30,142,368 Q164K probably benign Het
Tfpi AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA AATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA 2: 84,434,424 probably benign Het
Tpm2 T C 4: 43,518,968 probably benign Het
Triobp T C 15: 78,968,267 C874R probably benign Het
Tymp T A 15: 89,374,331 H269L probably damaging Het
Vmn1r194 T A 13: 22,244,427 Y71* probably null Het
Vmn2r102 T C 17: 19,677,542 V273A probably benign Het
Vmn2r2 A T 3: 64,117,394 C589S probably damaging Het
Vps13a T C 19: 16,666,324 T2063A probably benign Het
Ywhaz T C 15: 36,775,266 I217M probably damaging Het
Zfp322a A C 13: 23,357,409 Y54* probably null Het
Zswim9 A T 7: 13,260,735 V498D probably damaging Het
Other mutations in Npm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02208:Npm3 APN 19 45748860 missense probably benign 0.33
R0329:Npm3 UTSW 19 45749526 missense probably benign 0.06
R0375:Npm3 UTSW 19 45748229 missense probably damaging 1.00
R4044:Npm3 UTSW 19 45748253 missense possibly damaging 0.90
R7049:Npm3 UTSW 19 45749555 start codon destroyed probably null 0.02
R8032:Npm3 UTSW 19 45748243 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAACATACGGAGCATGGCAC -3'
(R):5'- AACTTGCTGTACCCTGCCTG -3'

Sequencing Primer
(F):5'- CCTGTAGCAAGCAGTTACCTG -3'
(R):5'- AACTCCAGCGAGGTGGGTG -3'
Posted On2016-12-15