Incidental Mutation 'R3907:Gphn'
List |< first << previous [record 27 of 62] next >> last >|
ID310268
Institutional Source Beutler Lab
Gene Symbol Gphn
Ensembl Gene ENSMUSG00000047454
Gene Namegephyrin
Synonyms5730552E08Rik, geph
MMRRC Submission 040908-MU
Accession Numbers

Genbank: NM_145965, NM_172952; MGI: 109602

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3907 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location78226379-78684772 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 78493942 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052472] [ENSMUST00000110388]
Predicted Effect probably benign
Transcript: ENSMUST00000052472
SMART Domains Protein: ENSMUSP00000054064
Gene: ENSMUSG00000047454

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 356 522 5.6e-53 PFAM
MoCF_biosynth 535 678 8.1e-38 SMART
Pfam:MoeA_C 691 766 8.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110388
SMART Domains Protein: ENSMUSP00000106018
Gene: ENSMUSG00000047454

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 360 525 2.1e-35 PFAM
MoCF_biosynth 538 681 8.1e-38 SMART
Pfam:MoeA_C 694 769 8.1e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal assembly protein that anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die within one day of birth, apparently due to an inability to suckle. Apnea also develops within 12 hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,736,576 A663T probably damaging Het
Adamts3 C A 5: 89,861,355 G150C probably damaging Het
Ampd3 A G 7: 110,793,670 D215G possibly damaging Het
Ank2 A G 3: 127,016,898 L513P probably damaging Het
Apba1 T C 19: 23,937,506 I690T probably damaging Het
Arid1a T C 4: 133,692,912 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asns C T 6: 7,682,270 probably null Het
Aspg T A 12: 112,112,259 Y57* probably null Het
Asph T C 4: 9,474,934 K680R probably benign Het
Atp2b4 A T 1: 133,738,586 S243T probably damaging Het
Cacna1s T A 1: 136,084,269 M483K probably damaging Het
Car4 G A 11: 84,964,357 V141M probably damaging Het
Cct4 A G 11: 23,001,560 I376V probably benign Het
Chrm4 C T 2: 91,927,739 A164V probably damaging Het
Csf3r A T 4: 126,034,447 D291V probably benign Het
Dcaf6 A T 1: 165,424,380 C58* probably null Het
Ddi2 T C 4: 141,684,281 D440G probably benign Het
Defb4 A T 8: 19,201,261 Q48L possibly damaging Het
Duox2 C T 2: 122,283,060 probably null Het
E130308A19Rik C T 4: 59,752,393 T502I probably benign Het
Ephb1 A G 9: 102,001,726 C522R probably benign Het
Fam76a T C 4: 132,916,121 K101E probably damaging Het
Fat1 G C 8: 45,023,035 R1706T probably benign Het
Fn1 C T 1: 71,607,913 G1482R probably damaging Het
Gm10110 T C 14: 89,898,147 noncoding transcript Het
Hars A T 18: 36,782,716 D48E probably benign Het
Hmgcll1 G A 9: 76,072,661 R111H probably benign Het
Ighv3-4 A G 12: 114,253,918 S18P probably damaging Het
Iws1 G A 18: 32,079,920 E134K possibly damaging Het
Kcnj4 G T 15: 79,485,745 H11Q probably benign Het
Krt16 A G 11: 100,247,163 V329A possibly damaging Het
Loxhd1 A T 18: 77,408,768 M1575L possibly damaging Het
Mapkapk2 A T 1: 131,056,914 S234T probably damaging Het
Mum1 T C 10: 80,238,316 V401A probably damaging Het
Mxd1 G T 6: 86,650,960 Q199K probably benign Het
Nlrp5 T A 7: 23,433,646 D905E possibly damaging Het
Olfr1222 A C 2: 89,125,583 Y49* probably null Het
Olfr5 A T 7: 6,480,679 V159D probably damaging Het
Otoa A T 7: 121,125,565 Q489L probably damaging Het
Pced1b T C 15: 97,384,550 S157P probably damaging Het
Ppp1r16b T C 2: 158,761,490 I345T probably benign Het
Prrt4 G T 6: 29,177,174 L199M probably damaging Het
Ptpn6 T C 6: 124,725,276 D347G possibly damaging Het
Rcan1 A G 16: 92,466,029 probably benign Het
Rif1 C T 2: 52,112,545 L2004F probably benign Het
Rnf185 A G 11: 3,426,681 probably benign Het
Shank2 C T 7: 144,409,576 P307L probably damaging Het
Slc19a3 G A 1: 83,014,813 R396C possibly damaging Het
Stn1 T C 19: 47,507,823 D321G probably damaging Het
Taar7a T C 10: 23,992,559 Y308C probably benign Het
Tespa1 T C 10: 130,356,797 probably benign Het
Tmcc2 T C 1: 132,360,638 D359G probably damaging Het
Trhde C T 10: 114,800,696 G202E possibly damaging Het
Trip12 T C 1: 84,732,106 T469A possibly damaging Het
Trip4 A G 9: 65,833,426 I533T probably benign Het
Tsc22d1 T C 14: 76,416,543 I154T probably damaging Het
Ttn C A 2: 76,903,342 probably benign Het
Ugt8a T C 3: 125,914,982 T160A possibly damaging Het
Usp54 A T 14: 20,586,113 S288T probably damaging Het
Utrn C T 10: 12,710,182 probably benign Het
Other mutations in Gphn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gphn APN 12 78504632 missense probably damaging 1.00
IGL00701:Gphn APN 12 78626167 missense possibly damaging 0.93
IGL00844:Gphn APN 12 78664568 splice site probably benign
IGL01517:Gphn APN 12 78376374 missense probably damaging 1.00
IGL02499:Gphn APN 12 78492300 missense probably benign 0.17
IGL02827:Gphn APN 12 78609220 missense probably damaging 1.00
IGL03136:Gphn APN 12 78481333 missense possibly damaging 0.69
IGL03348:Gphn APN 12 78627119 missense probably damaging 0.99
IGL03382:Gphn APN 12 78481313 missense probably damaging 1.00
grizzlies UTSW 12 78654880 missense probably benign 0.28
3-1:Gphn UTSW 12 78613001 missense probably benign 0.06
R0054:Gphn UTSW 12 78637503 missense probably damaging 1.00
R0054:Gphn UTSW 12 78637503 missense probably damaging 1.00
R0212:Gphn UTSW 12 78637552 missense probably damaging 0.99
R0389:Gphn UTSW 12 78590659 missense probably damaging 1.00
R0535:Gphn UTSW 12 78492050 missense possibly damaging 0.90
R1464:Gphn UTSW 12 78612964 splice site probably benign
R1503:Gphn UTSW 12 78504629 missense possibly damaging 0.94
R1606:Gphn UTSW 12 78683883 missense probably damaging 1.00
R1896:Gphn UTSW 12 78412354 missense possibly damaging 0.74
R2248:Gphn UTSW 12 78454821 missense probably damaging 1.00
R3708:Gphn UTSW 12 78532693 missense probably benign
R4537:Gphn UTSW 12 78494014 missense probably benign 0.03
R4667:Gphn UTSW 12 78454817 missense probably damaging 1.00
R4808:Gphn UTSW 12 78654880 missense probably benign 0.28
R4840:Gphn UTSW 12 78522955 critical splice donor site probably null
R4852:Gphn UTSW 12 78627210 missense probably damaging 1.00
R4854:Gphn UTSW 12 78627210 missense probably damaging 1.00
R4855:Gphn UTSW 12 78627210 missense probably damaging 1.00
R5083:Gphn UTSW 12 78623289 splice site probably null
R5224:Gphn UTSW 12 78590587 missense probably damaging 0.99
R5580:Gphn UTSW 12 78492044 missense probably damaging 1.00
R5626:Gphn UTSW 12 78683897 missense probably benign 0.11
R6270:Gphn UTSW 12 78522950 missense probably benign
R6563:Gphn UTSW 12 78680396 critical splice donor site probably null
R6943:Gphn UTSW 12 78492181 missense possibly damaging 0.88
R6958:Gphn UTSW 12 78680299 missense possibly damaging 0.86
R7170:Gphn UTSW 12 78683889 missense possibly damaging 0.67
R7295:Gphn UTSW 12 78492102 missense probably benign 0.02
R7514:Gphn UTSW 12 78626165 missense probably damaging 0.97
R7537:Gphn UTSW 12 78504680 missense possibly damaging 0.62
R7680:Gphn UTSW 12 78412374 missense probably benign 0.14
R8236:Gphn UTSW 12 78664537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGATTTATTGAGCTGTAAGAAC -3'
(R):5'- GTTTATAGCCCACCTCCAAATAAAG -3'

Sequencing Primer
(F):5'- AGTTCTTTCATTGAACACTGTCG -3'
(R):5'- GCCCACCTCCAAATAAAGAAGTATG -3'
Posted On2015-04-17