Mutagenetix > Incidental Mutation

Incidental Mutation 'R3907:Shank2'

310253

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

040908-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3907 (G1)

Quality Score

212

Status

Validated

Chromosome

Chromosomal Location

144001928-144424494 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 144409576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 307 (P307L)

Ref Sequence

ENSEMBL: ENSMUSP00000146440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097929] [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000146006]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000097929
AA Change: P300L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095542
Gene: ENSMUSG00000037541
AA Change: P300L

Domain	Start	End	E-Value	Type
PDZ	46	131	1.75e-14	SMART
low complexity region	135	154	N/A	INTRINSIC
low complexity region	299	314	N/A	INTRINSIC
low complexity region	452	464	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	570	582	N/A	INTRINSIC
low complexity region	619	637	N/A	INTRINSIC
low complexity region	814	828	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	915	937	N/A	INTRINSIC
low complexity region	951	967	N/A	INTRINSIC
low complexity region	989	997	N/A	INTRINSIC
low complexity region	1077	1091	N/A	INTRINSIC
low complexity region	1134	1149	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
SAM	1196	1262	2.52e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105900
AA Change: P517L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: P517L

Domain	Start	End	E-Value	Type
SH3	150	205	1.04e-14	SMART
PDZ	256	341	1.75e-14	SMART
low complexity region	345	364	N/A	INTRINSIC
low complexity region	509	524	N/A	INTRINSIC
low complexity region	662	674	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	829	847	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1093	1104	N/A	INTRINSIC
low complexity region	1125	1147	N/A	INTRINSIC
low complexity region	1161	1177	N/A	INTRINSIC
low complexity region	1199	1207	N/A	INTRINSIC
low complexity region	1287	1301	N/A	INTRINSIC
low complexity region	1344	1359	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
SAM	1406	1472	2.52e-23	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105902
AA Change: P886L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: P886L

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125355

Predicted Effect

probably damaging
Transcript: ENSMUST00000146006
AA Change: P307L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.1914

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,736,576	A663T	probably damaging	Het
Adamts3	C	A	5: 89,861,355	G150C	probably damaging	Het
Ampd3	A	G	7: 110,793,670	D215G	possibly damaging	Het
Ank2	A	G	3: 127,016,898	L513P	probably damaging	Het
Apba1	T	C	19: 23,937,506	I690T	probably damaging	Het
Arid1a	T	C	4: 133,692,912		probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asns	C	T	6: 7,682,270		probably null	Het
Aspg	T	A	12: 112,112,259	Y57*	probably null	Het
Asph	T	C	4: 9,474,934	K680R	probably benign	Het
Atp2b4	A	T	1: 133,738,586	S243T	probably damaging	Het
Cacna1s	T	A	1: 136,084,269	M483K	probably damaging	Het
Car4	G	A	11: 84,964,357	V141M	probably damaging	Het
Cct4	A	G	11: 23,001,560	I376V	probably benign	Het
Chrm4	C	T	2: 91,927,739	A164V	probably damaging	Het
Csf3r	A	T	4: 126,034,447	D291V	probably benign	Het
Dcaf6	A	T	1: 165,424,380	C58*	probably null	Het
Ddi2	T	C	4: 141,684,281	D440G	probably benign	Het
Defb4	A	T	8: 19,201,261	Q48L	possibly damaging	Het
Duox2	C	T	2: 122,283,060		probably null	Het
E130308A19Rik	C	T	4: 59,752,393	T502I	probably benign	Het
Ephb1	A	G	9: 102,001,726	C522R	probably benign	Het
Fam76a	T	C	4: 132,916,121	K101E	probably damaging	Het
Fat1	G	C	8: 45,023,035	R1706T	probably benign	Het
Fn1	C	T	1: 71,607,913	G1482R	probably damaging	Het
Gm10110	T	C	14: 89,898,147		noncoding transcript	Het
Gphn	T	A	12: 78,493,942		probably benign	Het
Hars	A	T	18: 36,782,716	D48E	probably benign	Het
Hmgcll1	G	A	9: 76,072,661	R111H	probably benign	Het
Ighv3-4	A	G	12: 114,253,918	S18P	probably damaging	Het
Iws1	G	A	18: 32,079,920	E134K	possibly damaging	Het
Kcnj4	G	T	15: 79,485,745	H11Q	probably benign	Het
Krt16	A	G	11: 100,247,163	V329A	possibly damaging	Het
Loxhd1	A	T	18: 77,408,768	M1575L	possibly damaging	Het
Mapkapk2	A	T	1: 131,056,914	S234T	probably damaging	Het
Mum1	T	C	10: 80,238,316	V401A	probably damaging	Het
Mxd1	G	T	6: 86,650,960	Q199K	probably benign	Het
Nlrp5	T	A	7: 23,433,646	D905E	possibly damaging	Het
Olfr1222	A	C	2: 89,125,583	Y49*	probably null	Het
Olfr5	A	T	7: 6,480,679	V159D	probably damaging	Het
Otoa	A	T	7: 121,125,565	Q489L	probably damaging	Het
Pced1b	T	C	15: 97,384,550	S157P	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,490	I345T	probably benign	Het
Prrt4	G	T	6: 29,177,174	L199M	probably damaging	Het
Ptpn6	T	C	6: 124,725,276	D347G	possibly damaging	Het
Rcan1	A	G	16: 92,466,029		probably benign	Het
Rif1	C	T	2: 52,112,545	L2004F	probably benign	Het
Rnf185	A	G	11: 3,426,681		probably benign	Het
Slc19a3	G	A	1: 83,014,813	R396C	possibly damaging	Het
Stn1	T	C	19: 47,507,823	D321G	probably damaging	Het
Taar7a	T	C	10: 23,992,559	Y308C	probably benign	Het
Tespa1	T	C	10: 130,356,797		probably benign	Het
Tmcc2	T	C	1: 132,360,638	D359G	probably damaging	Het
Trhde	C	T	10: 114,800,696	G202E	possibly damaging	Het
Trip12	T	C	1: 84,732,106	T469A	possibly damaging	Het
Trip4	A	G	9: 65,833,426	I533T	probably benign	Het
Tsc22d1	T	C	14: 76,416,543	I154T	probably damaging	Het
Ttn	C	A	2: 76,903,342		probably benign	Het
Ugt8a	T	C	3: 125,914,982	T160A	possibly damaging	Het
Usp54	A	T	14: 20,586,113	S288T	probably damaging	Het
Utrn	C	T	10: 12,710,182		probably benign	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	144411847	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	144410775	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	144411271	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	144285068	nonsense	probably null
IGL01996:Shank2	APN	7	144411493	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	144285047	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	144411271	missense	probably benign	0.01
IGL02320:Shank2	APN	7	144420944	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	144409636	missense	probably benign	0.03
IGL02997:Shank2	APN	7	144081873	missense	probably benign	0.16
R0077:Shank2	UTSW	7	144192467	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	144410577	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	144031355	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	144070135	missense	probably benign	0.04
R0644:Shank2	UTSW	7	144411849	missense	probably benign
R1072:Shank2	UTSW	7	144411568	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	144411720	missense	probably benign	0.00
R1424:Shank2	UTSW	7	144052372	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	144411153	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	144179853	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	144410599	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	144186858	nonsense	probably null
R2074:Shank2	UTSW	7	144409540	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	144411234	missense	probably damaging	0.99
R2355:Shank2	UTSW	7	144057718	missense	possibly damaging	0.94
R2511:Shank2	UTSW	7	144411577	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	144052305	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	144068770	missense	probably damaging	1.00
R2846:Shank2	UTSW	7	144070055	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	144081874	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	144405384	missense	probably benign
R3938:Shank2	UTSW	7	144128375	missense	probably benign	0.20
R4151:Shank2	UTSW	7	144054828	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	144179781	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	144410862	missense	probably benign	0.09
R4519:Shank2	UTSW	7	144410205	missense	probably damaging	1.00
R4627:Shank2	UTSW	7	144411424	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	144410422	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	144411829	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	144420605	missense	probably benign	0.07
R4751:Shank2	UTSW	7	144409468	missense	probably damaging	1.00
R4816:Shank2	UTSW	7	144052306	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R4929:Shank2	UTSW	7	144411271	missense	probably benign	0.01
R5009:Shank2	UTSW	7	144070179	missense	probably benign	0.00
R5027:Shank2	UTSW	7	144259105	nonsense	probably null
R5165:Shank2	UTSW	7	144409636	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	144068875	critical splice donor site	probably null
R5332:Shank2	UTSW	7	144411292	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R5525:Shank2	UTSW	7	144070109	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	144410134	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	144407223	missense	probably damaging	0.98
R6024:Shank2	UTSW	7	144180031	missense	probably benign	0.12
R6306:Shank2	UTSW	7	144409680	missense	probably benign	0.00
R6317:Shank2	UTSW	7	144285084	missense	possibly damaging	0.89
R6358:Shank2	UTSW	7	144031297	missense	probably benign	0.25
R6364:Shank2	UTSW	7	144410409	missense	probably benign	0.14
R6413:Shank2	UTSW	7	144410218	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	144420866	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	144409894	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	144052460	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	144091778	missense	probably benign	0.19
R6983:Shank2	UTSW	7	144081848	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	144410359	missense	probably damaging	0.99
R7100:Shank2	UTSW	7	144411164	missense	possibly damaging	0.73
R7111:Shank2	UTSW	7	144411552	missense	probably benign	0.00
R7213:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R7225:Shank2	UTSW	7	144285025	missense	probably benign	0.42
R7325:Shank2	UTSW	7	144411685	missense	probably benign	0.04
R7605:Shank2	UTSW	7	144091779	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	144411394	missense	probably damaging	1.00
R7976:Shank2	UTSW	7	144411061	missense	probably damaging	0.99
R8118:Shank2	UTSW	7	144409875	missense	probably benign	0.01
R8722:Shank2	UTSW	7	144175748	intron	probably benign
R8866:Shank2	UTSW	7	144411249	missense	probably benign
R8919:Shank2	UTSW	7	144411528	missense	probably damaging	1.00
R8944:Shank2	UTSW	7	144070190	missense	probably damaging	1.00
R9033:Shank2	UTSW	7	144411499	missense	probably damaging	0.99
R9091:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9252:Shank2	UTSW	7	144068798	missense	possibly damaging	0.96
R9270:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9350:Shank2	UTSW	7	144407208	missense	probably benign	0.00
R9362:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R9471:Shank2	UTSW	7	144411015	missense	possibly damaging	0.77
R9524:Shank2	UTSW	7	144410446	missense	possibly damaging	0.71
R9557:Shank2	UTSW	7	144410110	missense	probably benign	0.00
R9559:Shank2	UTSW	7	144031304	missense	probably benign	0.30
R9574:Shank2	UTSW	7	144068725	missense	possibly damaging	0.90
R9680:Shank2	UTSW	7	144411100	missense	probably damaging	0.96
R9720:Shank2	UTSW	7	144128400	missense	probably damaging	0.99
RF009:Shank2	UTSW	7	144411571	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	144128377	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCTGTCTGAGTCTGTGGAAAC -3'
(R):5'- TGAGTCCAGGGAAAATCTGTCC -3'

Sequencing Primer
(F):5'- TGGAAACACAGTGTATTACACAGTCC -3'
(R):5'- GGGAAAATCTGTCCAGCTCTC -3'

Posted On

2015-04-17