Mutagenetix > Incidental Mutation

Incidental Mutation 'R3956:Clspn'

310686

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

040833-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3956 (G1)

Quality Score

102

Status

Validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

ACGGCGGCGGC to A at 126566437 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000045344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391] [ENSMUST00000129795]

AlphaFold

Q80YR7

Predicted Effect

probably null
Transcript: ENSMUST00000048391

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123695

Predicted Effect

probably benign
Transcript: ENSMUST00000126512

SMART Domains

Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
coiled coil region	74	101	N/A	INTRINSIC
low complexity region	108	147	N/A	INTRINSIC
low complexity region	153	170	N/A	INTRINSIC
low complexity region	221	242	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129795

SMART Domains

Protein: ENSMUSP00000120683
Gene: ENSMUSG00000042489

Domain	Start	End	E-Value	Type
low complexity region	50	66	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.5%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	A	G	13: 58,384,389	S118P	probably damaging	Het
9330159F19Rik	A	G	10: 29,224,809	K393E	possibly damaging	Het
Aagab	A	G	9: 63,619,160	E155G	probably damaging	Het
Abca16	A	G	7: 120,527,752	N1221S	probably damaging	Het
Acad11	A	G	9: 104,086,152		probably benign	Het
Acsl1	T	A	8: 46,534,458	L693Q	probably damaging	Het
Adam2	G	A	14: 66,057,610	S262L	probably damaging	Het
B3gat1	A	G	9: 26,757,028	T305A	possibly damaging	Het
BC051076	A	G	5: 87,964,251		noncoding transcript	Het
Ccni	A	G	5: 93,183,404	L236S	probably damaging	Het
Cdc45	A	G	16: 18,805,430	V119A	probably benign	Het
Creld1	A	G	6: 113,492,229	D340G	possibly damaging	Het
Dnah2	T	A	11: 69,484,021	I1417L	probably benign	Het
Efhc1	A	C	1: 20,978,666	K434N	probably damaging	Het
Evi5l	T	C	8: 4,191,358	V297A	possibly damaging	Het
Fam49b	T	C	15: 63,941,974	Y158C	probably damaging	Het
Fam58b	C	A	11: 78,751,023	E214*	probably null	Het
Fam69b	C	T	2: 26,635,567	P171L	probably benign	Het
Fkbp8	T	G	8: 70,534,867	S376A	probably damaging	Het
Gfod1	A	T	13: 43,201,062	C146S	probably damaging	Het
Gm8882	G	T	6: 132,361,851	Q135K	unknown	Het
Gm960	T	A	19: 4,692,497	T214S	probably benign	Het
Greb1	G	T	12: 16,682,299	P1554T	probably damaging	Het
Grip1	A	T	10: 119,930,026	I88F	probably damaging	Het
Hbq1a	T	C	11: 32,300,214		probably null	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Kmt2e	A	G	5: 23,496,025	T121A	probably benign	Het
Lmf1	G	A	17: 25,654,471	V317M	probably damaging	Het
Mfsd2b	A	T	12: 4,866,848	F194Y	probably damaging	Het
Mtmr3	A	T	11: 4,491,138	V504E	probably damaging	Het
Neb	C	T	2: 52,201,963	V5030M	possibly damaging	Het
Nup210l	A	T	3: 90,193,054	R1462S	possibly damaging	Het
Olfr1039	C	T	2: 86,131,019	V215I	probably benign	Het
Olfr1042	A	G	2: 86,159,938	V144A	probably benign	Het
Olfr199	G	A	16: 59,216,065	Q183*	probably null	Het
Pmfbp1	A	G	8: 109,530,169	S502G	probably benign	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
Ralgapa2	C	T	2: 146,435,964	V426I	probably damaging	Het
Rasgrf2	A	G	13: 91,982,855	S696P	probably damaging	Het
Riok3	T	A	18: 12,142,974	Y242*	probably null	Het
Robo2	T	G	16: 73,961,867	Y672S	probably damaging	Het
Rsbn1	A	G	3: 103,928,675	H343R	probably damaging	Het
Sar1a	A	T	10: 61,686,393	N88I	possibly damaging	Het
Sgcz	A	G	8: 37,526,192		probably benign	Het
Tbc1d9	C	T	8: 83,233,532	T138I	probably damaging	Het
Tex37	A	G	6: 70,913,485	Y108H	possibly damaging	Het
Tmem131l	C	A	3: 83,910,419	C1257F	probably damaging	Het
Tmem136	C	A	9: 43,111,513	C182F	probably damaging	Het
Ttn	A	G	2: 76,969,249	V429A	possibly damaging	Het
Umodl1	A	G	17: 31,002,863	T1280A	probably benign	Het
Xpnpep3	A	G	15: 81,451,029		probably benign	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCATGTCACAGCAGGAATCCTC -3'
(R):5'- CTTCCACAGCAGCAAAAGTTG -3'

Sequencing Primer
(F):5'- GGAATCCTCCATCCCCAGG -3'
(R):5'- GGTAGGAACCACCCCAGAG -3'

Posted On

2015-04-29