Incidental Mutation 'R4158:Oasl1'
ID315621
Institutional Source Beutler Lab
Gene Symbol Oasl1
Ensembl Gene ENSMUSG00000041827
Gene Name2'-5' oligoadenylate synthetase-like 1
Synonyms
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114923240-114937915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114937014 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 378 (K378E)
Ref Sequence ENSEMBL: ENSMUSP00000107771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031540] [ENSMUST00000112143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031540
AA Change: K378E

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031540
Gene: ENSMUSG00000041827
AA Change: K378E

DomainStartEndE-ValueType
low complexity region 31 42 N/A INTRINSIC
Pfam:OAS1_C 162 348 8e-76 PFAM
UBQ 350 425 1.58e0 SMART
UBQ 430 501 2.22e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112143
AA Change: K378E

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107771
Gene: ENSMUSG00000041827
AA Change: K378E

DomainStartEndE-ValueType
low complexity region 31 42 N/A INTRINSIC
Pfam:OAS1_C 163 346 1.9e-79 PFAM
UBQ 350 425 1.58e0 SMART
UBQ 430 501 2.22e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155394
Meta Mutation Damage Score 0.0817 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Mice with a deletion of this gene have increased expression of type I interferon and show increased resistance to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Oasl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Oasl1 APN 5 114937407 missense probably benign 0.01
IGL02061:Oasl1 APN 5 114923592 missense probably damaging 0.97
IGL02888:Oasl1 APN 5 114937182 missense probably damaging 1.00
IGL03230:Oasl1 APN 5 114937056 missense probably damaging 1.00
dreadnaught UTSW 5 114936070 critical splice donor site probably null
nautilus UTSW 5 114937183 missense probably damaging 1.00
IGL03048:Oasl1 UTSW 5 114937341 missense possibly damaging 0.56
R1510:Oasl1 UTSW 5 114928108 missense probably benign 0.00
R1680:Oasl1 UTSW 5 114935944 missense probably damaging 1.00
R1918:Oasl1 UTSW 5 114923469 missense possibly damaging 0.84
R2090:Oasl1 UTSW 5 114935934 missense probably damaging 1.00
R3977:Oasl1 UTSW 5 114932898 missense probably damaging 1.00
R3978:Oasl1 UTSW 5 114932898 missense probably damaging 1.00
R3980:Oasl1 UTSW 5 114932898 missense probably damaging 1.00
R4159:Oasl1 UTSW 5 114937014 missense possibly damaging 0.77
R4160:Oasl1 UTSW 5 114937014 missense possibly damaging 0.77
R4161:Oasl1 UTSW 5 114937014 missense possibly damaging 0.77
R4797:Oasl1 UTSW 5 114928158 missense probably benign 0.00
R5354:Oasl1 UTSW 5 114936996 missense probably damaging 1.00
R5443:Oasl1 UTSW 5 114936070 critical splice donor site probably null
R5820:Oasl1 UTSW 5 114936978 missense possibly damaging 0.94
R5919:Oasl1 UTSW 5 114928270 missense probably damaging 1.00
R6746:Oasl1 UTSW 5 114937183 missense probably damaging 1.00
R7471:Oasl1 UTSW 5 114935926 missense probably damaging 1.00
R7720:Oasl1 UTSW 5 114929921 missense probably damaging 1.00
R7766:Oasl1 UTSW 5 114937110 missense probably damaging 1.00
Z1177:Oasl1 UTSW 5 114932745 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGCGTTCCCTAAACATTTGC -3'
(R):5'- TCACAAAGACCTGGATCTCAG -3'

Sequencing Primer
(F):5'- CCTAAACATTTGCTGCGGAG -3'
(R):5'- CTCAGGGGAGATGGTGTCCAG -3'
Posted On2015-05-14