Incidental Mutation 'R4072:Pidd1'
ID 316344
Institutional Source Beutler Lab
Gene Symbol Pidd1
Ensembl Gene ENSMUSG00000025507
Gene Name p53 induced death domain protein 1
Synonyms Lrdd, Pidd, 1200011D09Rik
MMRRC Submission 040854-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4072 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 141018026-141023938 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141020739 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 453 (F453L)
Ref Sequence ENSEMBL: ENSMUSP00000101627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019226] [ENSMUST00000026580] [ENSMUST00000106005] [ENSMUST00000106006] [ENSMUST00000124266] [ENSMUST00000128703] [ENSMUST00000190068] [ENSMUST00000190882] [ENSMUST00000172654] [ENSMUST00000201710] [ENSMUST00000201822]
AlphaFold Q9ERV7
Predicted Effect probably benign
Transcript: ENSMUST00000019226
SMART Domains Protein: ENSMUSP00000019226
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 8.1e-26 PFAM
Pfam:Mito_carr 99 217 8.6e-19 PFAM
Pfam:Mito_carr 221 310 7.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000026580
AA Change: F453L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026580
Gene: ENSMUSG00000025507
AA Change: F453L

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:Peptidase_S68 426 459 3.5e-26 PFAM
Pfam:ZU5 463 551 5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106005
AA Change: F453L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101627
Gene: ENSMUSG00000025507
AA Change: F453L

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Pfam:ZU5 328 422 6.6e-11 PFAM
Pfam:Peptidase_S68 426 458 5.2e-21 PFAM
Pfam:ZU5 463 546 6.5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106006
SMART Domains Protein: ENSMUSP00000101628
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.8e-26 PFAM
Pfam:Mito_carr 99 137 5.6e-8 PFAM
Pfam:Mito_carr 134 216 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124266
SMART Domains Protein: ENSMUSP00000122177
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128703
SMART Domains Protein: ENSMUSP00000139487
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
LRR 244 266 3.1e-2 SMART
LRR 267 286 1.3e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130878
Predicted Effect probably benign
Transcript: ENSMUST00000190068
SMART Domains Protein: ENSMUSP00000139957
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190882
SMART Domains Protein: ENSMUSP00000139785
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR_TYP 221 244 3.7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172654
SMART Domains Protein: ENSMUSP00000133928
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 1 54 6.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201710
SMART Domains Protein: ENSMUSP00000144231
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.7e-26 PFAM
Pfam:Mito_carr 99 217 2.3e-18 PFAM
Pfam:Mito_carr 221 311 5.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201822
SMART Domains Protein: ENSMUSP00000144213
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 70 1.2e-18 PFAM
Meta Mutation Damage Score 0.7281 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a leucine-rich repeat and a death domain. This protein has been shown to interact with other death domain proteins, such as Fas (TNFRSF6)-associated via death domain (FADD) and MAP-kinase activating death domain-containing protein (MADD), and thus may function as an adaptor protein in cell death-related signaling processes. The expression of the mouse counterpart of this gene has been found to be positively regulated by the tumor suppressor p53 and to induce cell apoptosis in response to DNA damage, which suggests a role for this gene as an effector of p53-dependent apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele were viable and did not show fertility problems, gender bias, other overt phenotype, or any gross abnormalities in histological assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,922,342 (GRCm39) probably null Het
Abcc5 A G 16: 20,152,445 (GRCm39) I1367T probably damaging Het
Acsm4 T A 7: 119,297,981 (GRCm39) L206H probably benign Het
Acss3 C T 10: 106,959,446 (GRCm39) probably benign Het
Adam34l A T 8: 44,079,387 (GRCm39) F279Y probably damaging Het
Ankar G T 1: 72,727,751 (GRCm39) D169E probably damaging Het
Arfgap3 C T 15: 83,187,330 (GRCm39) A510T probably damaging Het
Atp4a T C 7: 30,414,757 (GRCm39) I182T probably benign Het
Axl A G 7: 25,463,336 (GRCm39) probably benign Het
Baz1a A G 12: 54,988,345 (GRCm39) I268T probably benign Het
Baz2b A T 2: 59,742,917 (GRCm39) probably null Het
C2cd4d C A 3: 94,271,185 (GRCm39) C150* probably null Het
Crtac1 T C 19: 42,293,146 (GRCm39) Y321C probably damaging Het
Dnah11 T C 12: 118,070,227 (GRCm39) H1526R probably damaging Het
Dnah5 A T 15: 28,340,444 (GRCm39) R2284* probably null Het
Dnah9 T C 11: 65,975,730 (GRCm39) T1440A probably benign Het
Eps15l1 A G 8: 73,134,128 (GRCm39) I482T probably damaging Het
Eqtn A G 4: 94,808,199 (GRCm39) I201T possibly damaging Het
Ercc4 G A 16: 12,948,549 (GRCm39) V499I probably damaging Het
Eva1c T A 16: 90,701,019 (GRCm39) F331Y probably damaging Het
Fcho1 T C 8: 72,163,013 (GRCm39) H672R probably damaging Het
Galntl5 A T 5: 25,403,478 (GRCm39) K150* probably null Het
Gm19965 A G 1: 116,748,801 (GRCm39) T161A probably benign Het
Hydin G A 8: 111,231,888 (GRCm39) E1617K possibly damaging Het
Krtap31-1 T C 11: 99,799,058 (GRCm39) I87T possibly damaging Het
Lamp3 A G 16: 19,519,466 (GRCm39) L239P possibly damaging Het
Nlrp4c A G 7: 6,075,709 (GRCm39) K667E probably benign Het
Obox3 G T 7: 15,359,724 (GRCm39) T315N possibly damaging Het
Obscn A G 11: 58,888,009 (GRCm39) I7652T unknown Het
Or52e18 A T 7: 104,609,923 (GRCm39) N5K probably damaging Het
Or5b3 G A 19: 13,388,299 (GRCm39) R122H possibly damaging Het
Or8u8 T A 2: 86,011,991 (GRCm39) M155L probably benign Het
Pde7a G A 3: 19,311,017 (GRCm39) R70C probably damaging Het
Pms2 T C 5: 143,865,819 (GRCm39) I742T probably damaging Het
Pot1a T C 6: 25,752,356 (GRCm39) probably null Het
Pramel33 A T 5: 93,633,057 (GRCm39) M50K probably damaging Het
Rp1l1 A T 14: 64,265,581 (GRCm39) E389V probably damaging Het
Scnn1a A G 6: 125,315,870 (GRCm39) N407S probably damaging Het
Slc30a7 T C 3: 115,740,329 (GRCm39) D374G probably damaging Het
Slco2a1 T A 9: 102,945,201 (GRCm39) I192N probably damaging Het
Srp72 C A 5: 77,146,098 (GRCm39) T633K probably benign Het
Tm2d3 T A 7: 65,347,498 (GRCm39) L49* probably null Het
Tmprss11e T C 5: 86,863,502 (GRCm39) T188A possibly damaging Het
Tox T C 4: 6,842,396 (GRCm39) T45A probably damaging Het
Usp31 A G 7: 121,267,005 (GRCm39) probably null Het
Vwc2 T A 11: 11,066,446 (GRCm39) L178Q probably damaging Het
Zbbx C T 3: 75,012,978 (GRCm39) G151E probably damaging Het
Zbtb11 C T 16: 55,818,427 (GRCm39) T617I possibly damaging Het
Other mutations in Pidd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02751:Pidd1 APN 7 141,019,076 (GRCm39) missense possibly damaging 0.93
IGL02794:Pidd1 APN 7 141,023,021 (GRCm39) missense probably benign 0.00
IGL03083:Pidd1 APN 7 141,020,369 (GRCm39) critical splice donor site probably null
IGL03347:Pidd1 APN 7 141,019,081 (GRCm39) missense probably damaging 0.97
R0329:Pidd1 UTSW 7 141,019,474 (GRCm39) unclassified probably benign
R0426:Pidd1 UTSW 7 141,019,046 (GRCm39) missense probably damaging 1.00
R0650:Pidd1 UTSW 7 141,020,726 (GRCm39) nonsense probably null
R0651:Pidd1 UTSW 7 141,020,726 (GRCm39) nonsense probably null
R1201:Pidd1 UTSW 7 141,020,187 (GRCm39) missense probably benign
R1221:Pidd1 UTSW 7 141,018,725 (GRCm39) missense probably damaging 1.00
R1613:Pidd1 UTSW 7 141,020,690 (GRCm39) missense probably damaging 1.00
R1763:Pidd1 UTSW 7 141,019,543 (GRCm39) missense probably benign
R3967:Pidd1 UTSW 7 141,018,995 (GRCm39) missense possibly damaging 0.86
R4073:Pidd1 UTSW 7 141,020,739 (GRCm39) missense probably damaging 1.00
R4075:Pidd1 UTSW 7 141,020,739 (GRCm39) missense probably damaging 1.00
R4076:Pidd1 UTSW 7 141,020,739 (GRCm39) missense probably damaging 1.00
R4157:Pidd1 UTSW 7 141,021,279 (GRCm39) missense possibly damaging 0.87
R4501:Pidd1 UTSW 7 141,021,356 (GRCm39) unclassified probably benign
R4700:Pidd1 UTSW 7 141,022,162 (GRCm39) missense probably damaging 1.00
R4797:Pidd1 UTSW 7 141,022,899 (GRCm39) missense possibly damaging 0.92
R4985:Pidd1 UTSW 7 141,018,504 (GRCm39) makesense probably null
R5402:Pidd1 UTSW 7 141,018,507 (GRCm39) missense probably damaging 1.00
R5684:Pidd1 UTSW 7 141,021,024 (GRCm39) splice site probably null
R5790:Pidd1 UTSW 7 141,021,305 (GRCm39) unclassified probably benign
R5909:Pidd1 UTSW 7 141,021,183 (GRCm39) missense probably damaging 1.00
R6275:Pidd1 UTSW 7 141,019,708 (GRCm39) missense probably damaging 1.00
R6582:Pidd1 UTSW 7 141,019,494 (GRCm39) missense probably damaging 1.00
R6814:Pidd1 UTSW 7 141,019,331 (GRCm39) missense probably benign 0.34
R6872:Pidd1 UTSW 7 141,019,331 (GRCm39) missense probably benign 0.34
R6935:Pidd1 UTSW 7 141,020,215 (GRCm39) missense probably damaging 1.00
R7088:Pidd1 UTSW 7 141,020,400 (GRCm39) missense probably damaging 1.00
R7133:Pidd1 UTSW 7 141,019,813 (GRCm39) missense probably benign 0.05
R7544:Pidd1 UTSW 7 141,020,252 (GRCm39) missense possibly damaging 0.81
R7821:Pidd1 UTSW 7 141,022,193 (GRCm39) missense probably benign 0.36
R7861:Pidd1 UTSW 7 141,020,055 (GRCm39) missense probably damaging 1.00
R7903:Pidd1 UTSW 7 141,019,744 (GRCm39) missense probably damaging 0.99
R8218:Pidd1 UTSW 7 141,019,566 (GRCm39) missense probably damaging 1.00
R9623:Pidd1 UTSW 7 141,021,678 (GRCm39) missense probably damaging 1.00
Z1176:Pidd1 UTSW 7 141,020,274 (GRCm39) missense probably benign 0.03
Z1177:Pidd1 UTSW 7 141,020,929 (GRCm39) missense probably damaging 1.00
Z1177:Pidd1 UTSW 7 141,018,609 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGAACCATTTCAGTGCCC -3'
(R):5'- ACCTAGAGACCCAACTGGAG -3'

Sequencing Primer
(F):5'- AGAACCATTTCAGTGCCCTCCTG -3'
(R):5'- CCCAACTGGAGGAAGAGGCAC -3'
Posted On 2015-05-15