Incidental Mutation 'R4080:Eif2a'
ID316795
Institutional Source Beutler Lab
Gene Symbol Eif2a
Ensembl Gene ENSMUSG00000027810
Gene Nameeukaryotic translation initiation factor 2A
SynonymsD3Ertd194e
MMRRC Submission 040856-MU
Accession Numbers

Genbank: NM_001005509.2; Ensembl: ENSMUST00000029387

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location58525821-58557501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58539629 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 92 (T92M)
Ref Sequence ENSEMBL: ENSMUSP00000029387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029387] [ENSMUST00000135876] [ENSMUST00000138848] [ENSMUST00000154219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029387
AA Change: T92M

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029387
Gene: ENSMUSG00000027810
AA Change: T92M

DomainStartEndE-ValueType
low complexity region 145 159 N/A INTRINSIC
Pfam:eIF2A 216 411 1e-77 PFAM
low complexity region 488 502 N/A INTRINSIC
coiled coil region 528 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138827
Predicted Effect probably benign
Transcript: ENSMUST00000138848
AA Change: T75M

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120901
Gene: ENSMUSG00000027810
AA Change: T75M

DomainStartEndE-ValueType
SCOP:d1kb0a2 27 160 5e-9 SMART
Pfam:eIF2A 199 251 1.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148251
Predicted Effect probably benign
Transcript: ENSMUST00000154219
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a eukaryotic translation initiation factor that catalyzes the formation of puromycin-sensitive 80 S preinitiation complexes and the poly(U)-directed synthesis of polyphenylalanine at low concentrations of Mg2+. This gene should not be confused with eIF2-alpha (EIF2S1, Gene ID: 1965), the alpha subunit of the eIF2 translation initiation complex. Although both of these proteins function in binding initiator tRNA to the 40 S ribosomal subunit, the encoded protein does so in a codon-dependent manner, whereas eIF2 complex requires GTP. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no visible phenotypes. [provided by MGI curators]
Allele List at MGI

All alleles(51) : Targeted, other(2) Gene trapped(49)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Eif2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02323:Eif2a APN 3 58548603 missense possibly damaging 0.89
IGL02823:Eif2a APN 3 58548671 missense probably benign 0.01
IGL03086:Eif2a APN 3 58541117 missense probably benign 0.00
IGL03165:Eif2a APN 3 58548628 nonsense probably null
1mM(1):Eif2a UTSW 3 58545303 missense possibly damaging 0.75
PIT4576001:Eif2a UTSW 3 58545553 missense probably damaging 1.00
R0540:Eif2a UTSW 3 58555652 critical splice donor site probably null
R0607:Eif2a UTSW 3 58555652 critical splice donor site probably null
R1061:Eif2a UTSW 3 58545065 nonsense probably null
R1499:Eif2a UTSW 3 58537584 nonsense probably null
R1922:Eif2a UTSW 3 58548530 missense probably damaging 1.00
R3980:Eif2a UTSW 3 58539539 missense probably benign 0.00
R4017:Eif2a UTSW 3 58545355 missense probably damaging 1.00
R5528:Eif2a UTSW 3 58548512 missense probably damaging 1.00
R6320:Eif2a UTSW 3 58557096 splice site probably null
R7081:Eif2a UTSW 3 58541718 critical splice donor site probably null
R7414:Eif2a UTSW 3 58526081 nonsense probably null
R7447:Eif2a UTSW 3 58545542 missense probably damaging 0.97
R7497:Eif2a UTSW 3 58548681 missense probably damaging 1.00
R7701:Eif2a UTSW 3 58552570 missense possibly damaging 0.72
R8205:Eif2a UTSW 3 58548735 missense probably damaging 1.00
Z1176:Eif2a UTSW 3 58548884 missense probably benign
Z1177:Eif2a UTSW 3 58531120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGTCCTATCACTTGTGGATC -3'
(R):5'- CATATTCCCTGCAGATGGCTG -3'

Sequencing Primer
(F):5'- TCTTGGAATTTCCTGAAAAGTGG -3'
(R):5'- CTGCAGATGGCTGGGTGTG -3'
Posted On2015-05-15