Mutagenetix > Incidental Mutations

Incidental Mutation 'R4080:Eif2a'

316795

Institutional Source

Beutler Lab

Gene Symbol

Eif2a

Ensembl Gene

ENSMUSG00000027810

Gene Name

eukaryotic translation initiation factor 2A

Synonyms

D3Ertd194e

MMRRC Submission

040856-MU

Accession Numbers

Genbank: NM_001005509.2; Ensembl: ENSMUST00000029387

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4080 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58525821-58557501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 58539629 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 92 (T92M)

Ref Sequence

ENSEMBL: ENSMUSP00000029387 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029387] [ENSMUST00000135876] [ENSMUST00000138848] [ENSMUST00000154219]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029387
AA Change: T92M

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029387
Gene: ENSMUSG00000027810
AA Change: T92M

Domain	Start	End	E-Value	Type
low complexity region	145	159	N/A	INTRINSIC
Pfam:eIF2A	216	411	1e-77	PFAM
low complexity region	488	502	N/A	INTRINSIC
coiled coil region	528	575	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135876

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137469

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138827

Predicted Effect

probably benign
Transcript: ENSMUST00000138848
AA Change: T75M

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000120901
Gene: ENSMUSG00000027810
AA Change: T75M

Domain	Start	End	E-Value	Type
SCOP:d1kb0a2	27	160	5e-9	SMART
Pfam:eIF2A	199	251	1.5e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148251

Predicted Effect

probably benign
Transcript: ENSMUST00000154219

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a eukaryotic translation initiation factor that catalyzes the formation of puromycin-sensitive 80 S preinitiation complexes and the poly(U)-directed synthesis of polyphenylalanine at low concentrations of Mg2+. This gene should not be confused with eIF2-alpha (EIF2S1, Gene ID: 1965), the alpha subunit of the eIF2 translation initiation complex. Although both of these proteins function in binding initiator tRNA to the 40 S ribosomal subunit, the encoded protein does so in a codon-dependent manner, whereas eIF2 complex requires GTP. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no visible phenotypes. [provided by MGI curators]

Allele List at MGI

All alleles(51) : Targeted, other(2) Gene trapped(49)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	G	T	12: 55,304,613	V236F	possibly damaging	Het
Aass	A	T	6: 23,109,498	D324E	possibly damaging	Het
Adam7	T	C	14: 68,520,539	T245A	probably benign	Het
Adgrf3	G	A	5: 30,197,369	Q554*	probably null	Het
Aim2	T	C	1: 173,459,851		probably null	Het
Arhgef1	G	T	7: 24,925,846	D850Y	probably damaging	Het
Aspm	C	A	1: 139,470,755	Q1024K	probably damaging	Het
C7	T	C	15: 4,990,464	S734G	probably benign	Het
Ccdc158	A	T	5: 92,623,396	S987T	probably benign	Het
Chrna2	G	T	14: 66,143,417	G45V	probably benign	Het
Chrna2	C	A	14: 66,143,424	Y47*	probably null	Het
Clec2g	C	A	6: 128,981,324	Q117K	probably damaging	Het
Cntnap5a	A	G	1: 116,101,574	S253G	probably benign	Het
Cttn	T	A	7: 144,457,724	D116V	probably damaging	Het
Cyp2c40	A	G	19: 39,802,529	V286A	probably benign	Het
Dcbld2	T	A	16: 58,465,373	S632T	probably damaging	Het
Dscam	A	T	16: 96,683,772	N1118K	probably benign	Het
Frmpd1	T	A	4: 45,284,382	C1068S	probably benign	Het
Fstl1	G	A	16: 37,822,603	V110I	probably benign	Het
Gpat2	T	C	2: 127,433,622	I465T	probably damaging	Het
Gpr137	C	T	19: 6,940,423		probably benign	Het
Hgsnat	A	G	8: 25,946,343	I561T	probably benign	Het
Ift74	T	A	4: 94,652,912		probably null	Het
Ilf3	A	G	9: 21,403,134		probably null	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrrc41	C	A	4: 116,080,546		probably null	Het
Myh11	C	A	16: 14,224,059	R700L	possibly damaging	Het
Myo16	A	G	8: 10,562,240	D1295G	probably damaging	Het
Myo5b	A	G	18: 74,740,488	M1488V	probably benign	Het
Naip6	A	T	13: 100,299,307	Y903N	probably damaging	Het
Nek6	A	G	2: 38,550,637	H19R	probably damaging	Het
Nktr	A	C	9: 121,741,126	T127P	probably damaging	Het
Noc4l	A	T	5: 110,649,872	D335E	probably benign	Het
Nsd1	A	G	13: 55,301,809	D1993G	probably damaging	Het
Olfr1377	G	A	11: 50,984,856	D52N	probably damaging	Het
Olfr190	A	T	16: 59,074,256	F275I	probably damaging	Het
Pabpc2	A	T	18: 39,775,530	Q616L	possibly damaging	Het
Pcdhga4	A	T	18: 37,685,779	D127V	probably damaging	Het
Phrf1	T	C	7: 141,259,720		probably benign	Het
Phtf2	T	A	5: 20,813,296	I16F	probably damaging	Het
Plekhg3	G	T	12: 76,577,981	R1200L	probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Prss12	A	G	3: 123,485,485	N404D	probably benign	Het
Ptch2	C	G	4: 117,111,206	A926G	probably damaging	Het
Ptpa	T	C	2: 30,443,305	F6L	probably damaging	Het
Reck	T	C	4: 43,942,293	I853T	possibly damaging	Het
Reep6	G	A	10: 80,330,162		probably benign	Het
Rex2	T	A	4: 147,058,697	S547R	probably benign	Het
Rgs22	C	T	15: 36,107,076	E55K	probably damaging	Het
Rtl6	T	C	15: 84,557,001	T65A	possibly damaging	Het
Scarb1	G	T	5: 125,277,795	P491Q	probably damaging	Het
Scfd1	A	G	12: 51,431,519	S505G	probably benign	Het
Scube1	T	G	15: 83,608,747	Q904P	probably damaging	Het
Sis	T	C	3: 72,921,184	Y1186C	probably damaging	Het
Spta1	A	G	1: 174,214,066	D1334G	probably benign	Het
Spty2d1	T	C	7: 46,998,581	E200G	probably damaging	Het
Stard13	C	A	5: 151,092,829		probably null	Het
Sybu	T	C	15: 44,718,943	K95R	probably damaging	Het
Trappc9	T	A	15: 72,941,947	D488V	probably damaging	Het
Txk	G	A	5: 72,700,663	P381S	probably damaging	Het
Ubr2	A	T	17: 46,988,722	M198K	probably benign	Het
Unc5a	A	T	13: 55,004,481	T786S	possibly damaging	Het
Unc93b1	G	A	19: 3,941,959	R231Q	probably damaging	Het
Wfdc1	T	A	8: 119,683,793		probably null	Het
Zfp667	T	G	7: 6,305,106	C258G	possibly damaging	Het
Zfr	G	A	15: 12,162,233	R823H	probably benign	Het

Other mutations in Eif2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02323:Eif2a	APN	3	58548603	missense	possibly damaging	0.89
IGL02823:Eif2a	APN	3	58548671	missense	probably benign	0.01
IGL03086:Eif2a	APN	3	58541117	missense	probably benign	0.00
IGL03165:Eif2a	APN	3	58548628	nonsense	probably null
1mM(1):Eif2a	UTSW	3	58545303	missense	possibly damaging	0.75
PIT4576001:Eif2a	UTSW	3	58545553	missense	probably damaging	1.00
R0540:Eif2a	UTSW	3	58555652	critical splice donor site	probably null
R0607:Eif2a	UTSW	3	58555652	critical splice donor site	probably null
R1061:Eif2a	UTSW	3	58545065	nonsense	probably null
R1499:Eif2a	UTSW	3	58537584	nonsense	probably null
R1922:Eif2a	UTSW	3	58548530	missense	probably damaging	1.00
R3980:Eif2a	UTSW	3	58539539	missense	probably benign	0.00
R4017:Eif2a	UTSW	3	58545355	missense	probably damaging	1.00
R5528:Eif2a	UTSW	3	58548512	missense	probably damaging	1.00
R6320:Eif2a	UTSW	3	58557096	intron	probably null
R7081:Eif2a	UTSW	3	58541718	critical splice donor site	probably null
R7414:Eif2a	UTSW	3	58526081	nonsense	probably null
R7447:Eif2a	UTSW	3	58545542	missense	probably damaging	0.97
R7497:Eif2a	UTSW	3	58548681	missense	probably damaging	1.00
R7701:Eif2a	UTSW	3	58552570	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- GGAAGTCCTATCACTTGTGGATC -3'
(R):5'- CATATTCCCTGCAGATGGCTG -3'

Sequencing Primer
(F):5'- TCTTGGAATTTCCTGAAAAGTGG -3'
(R):5'- CTGCAGATGGCTGGGTGTG -3'

Posted On

2015-05-15