Mutagenetix > Incidental Mutation

Incidental Mutation 'R4080:Trappc9'

316842

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

040856-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4080 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 72941947 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 488 (D488V)

Ref Sequence

ENSEMBL: ENSMUSP00000023276 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000023276
AA Change: D488V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: D488V

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000089770
AA Change: D667V

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: D667V

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168191
AA Change: D667V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: D667V

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	810	3.7e-222	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170633
AA Change: D676V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: D676V

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230270

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	G	T	12: 55,304,613	V236F	possibly damaging	Het
Aass	A	T	6: 23,109,498	D324E	possibly damaging	Het
Adam7	T	C	14: 68,520,539	T245A	probably benign	Het
Adgrf3	G	A	5: 30,197,369	Q554*	probably null	Het
Aim2	T	C	1: 173,459,851		probably null	Het
Arhgef1	G	T	7: 24,925,846	D850Y	probably damaging	Het
Aspm	C	A	1: 139,470,755	Q1024K	probably damaging	Het
C7	T	C	15: 4,990,464	S734G	probably benign	Het
Ccdc158	A	T	5: 92,623,396	S987T	probably benign	Het
Chrna2	G	T	14: 66,143,417	G45V	probably benign	Het
Chrna2	C	A	14: 66,143,424	Y47*	probably null	Het
Clec2g	C	A	6: 128,981,324	Q117K	probably damaging	Het
Cntnap5a	A	G	1: 116,101,574	S253G	probably benign	Het
Cttn	T	A	7: 144,457,724	D116V	probably damaging	Het
Cyp2c40	A	G	19: 39,802,529	V286A	probably benign	Het
Dcbld2	T	A	16: 58,465,373	S632T	probably damaging	Het
Dscam	A	T	16: 96,683,772	N1118K	probably benign	Het
Eif2a	C	T	3: 58,539,629	T92M	possibly damaging	Het
Frmpd1	T	A	4: 45,284,382	C1068S	probably benign	Het
Fstl1	G	A	16: 37,822,603	V110I	probably benign	Het
Gpat2	T	C	2: 127,433,622	I465T	probably damaging	Het
Gpr137	C	T	19: 6,940,423		probably benign	Het
Hgsnat	A	G	8: 25,946,343	I561T	probably benign	Het
Ift74	T	A	4: 94,652,912		probably null	Het
Ilf3	A	G	9: 21,403,134		probably null	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lrrc41	C	A	4: 116,080,546		probably null	Het
Myh11	C	A	16: 14,224,059	R700L	possibly damaging	Het
Myo16	A	G	8: 10,562,240	D1295G	probably damaging	Het
Myo5b	A	G	18: 74,740,488	M1488V	probably benign	Het
Naip6	A	T	13: 100,299,307	Y903N	probably damaging	Het
Nek6	A	G	2: 38,550,637	H19R	probably damaging	Het
Nktr	A	C	9: 121,741,126	T127P	probably damaging	Het
Noc4l	A	T	5: 110,649,872	D335E	probably benign	Het
Nsd1	A	G	13: 55,301,809	D1993G	probably damaging	Het
Olfr1377	G	A	11: 50,984,856	D52N	probably damaging	Het
Olfr190	A	T	16: 59,074,256	F275I	probably damaging	Het
Pabpc2	A	T	18: 39,775,530	Q616L	possibly damaging	Het
Pcdhga4	A	T	18: 37,685,779	D127V	probably damaging	Het
Phrf1	T	C	7: 141,259,720		probably benign	Het
Phtf2	T	A	5: 20,813,296	I16F	probably damaging	Het
Plekhg3	G	T	12: 76,577,981	R1200L	probably benign	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Prss12	A	G	3: 123,485,485	N404D	probably benign	Het
Ptch2	C	G	4: 117,111,206	A926G	probably damaging	Het
Ptpa	T	C	2: 30,443,305	F6L	probably damaging	Het
Reck	T	C	4: 43,942,293	I853T	possibly damaging	Het
Reep6	G	A	10: 80,330,162		probably benign	Het
Rex2	T	A	4: 147,058,697	S547R	probably benign	Het
Rgs22	C	T	15: 36,107,076	E55K	probably damaging	Het
Rtl6	T	C	15: 84,557,001	T65A	possibly damaging	Het
Scarb1	G	T	5: 125,277,795	P491Q	probably damaging	Het
Scfd1	A	G	12: 51,431,519	S505G	probably benign	Het
Scube1	T	G	15: 83,608,747	Q904P	probably damaging	Het
Sis	T	C	3: 72,921,184	Y1186C	probably damaging	Het
Spta1	A	G	1: 174,214,066	D1334G	probably benign	Het
Spty2d1	T	C	7: 46,998,581	E200G	probably damaging	Het
Stard13	C	A	5: 151,092,829		probably null	Het
Sybu	T	C	15: 44,718,943	K95R	probably damaging	Het
Txk	G	A	5: 72,700,663	P381S	probably damaging	Het
Ubr2	A	T	17: 46,988,722	M198K	probably benign	Het
Unc5a	A	T	13: 55,004,481	T786S	possibly damaging	Het
Unc93b1	G	A	19: 3,941,959	R231Q	probably damaging	Het
Wfdc1	T	A	8: 119,683,793		probably null	Het
Zfp667	T	G	7: 6,305,106	C258G	possibly damaging	Het
Zfr	G	A	15: 12,162,233	R823H	probably benign	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
bronto	UTSW	15	73058238	nonsense	probably null
Earl	UTSW	15	72736777	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8683:Trappc9	UTSW	15	73012815	missense	probably benign	0.26
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
R9083:Trappc9	UTSW	15	72736777	nonsense	probably null
R9323:Trappc9	UTSW	15	72693582	missense	probably benign	0.41
R9329:Trappc9	UTSW	15	72801353	missense	unknown
R9366:Trappc9	UTSW	15	72937088	missense	probably benign
R9723:Trappc9	UTSW	15	72590114	missense	possibly damaging	0.87
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- GCCTTACCCAAGTCAGATGAAC -3'
(R):5'- TCTGCTGCATTTTGTCCAAGG -3'

Sequencing Primer
(F):5'- GATGAACCCCAACCGTTTGTG -3'
(R):5'- TCCAAGGACAACCAGGGTCTTTG -3'

Posted On

2015-05-15