Incidental Mutation 'R4080:Trappc9'
ID316842
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Nametrafficking protein particle complex 9
SynonymsTRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
MMRRC Submission 040856-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location72589620-73061204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72941947 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 488 (D488V)
Ref Sequence ENSEMBL: ENSMUSP00000023276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633]
Predicted Effect probably damaging
Transcript: ENSMUST00000023276
AA Change: D488V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: D488V

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089770
AA Change: D667V

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: D667V

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168191
AA Change: D667V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: D667V

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170633
AA Change: D676V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: D676V

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230270
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- GCCTTACCCAAGTCAGATGAAC -3'
(R):5'- TCTGCTGCATTTTGTCCAAGG -3'

Sequencing Primer
(F):5'- GATGAACCCCAACCGTTTGTG -3'
(R):5'- TCCAAGGACAACCAGGGTCTTTG -3'
Posted On2015-05-15