Mutagenetix > Incidental Mutation

Incidental Mutation 'R1961:Akt3'

317894

Institutional Source

Beutler Lab

Gene Symbol

Akt3

Ensembl Gene

ENSMUSG00000019699

Gene Name

thymoma viral proto-oncogene 3

Synonyms

D930002M15Rik, Nmf350, PKB gamma

MMRRC Submission

039975-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.606) question?

Stock #

R1961 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

177020073-177258203 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 177096995 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 178 (I178T)

Ref Sequence

ENSEMBL: ENSMUSP00000106790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019843] [ENSMUST00000111159] [ENSMUST00000111160]

AlphaFold

Q9WUA6

Predicted Effect

probably damaging
Transcript: ENSMUST00000019843
AA Change: I178T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000019843
Gene: ENSMUSG00000019699
AA Change: I178T

Domain	Start	End	E-Value	Type
PH	6	109	4.81e-16	SMART
S_TKc	148	405	3.53e-106	SMART
S_TK_X	406	467	6.37e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111159
AA Change: I178T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000106789
Gene: ENSMUSG00000019699
AA Change: I178T

Domain	Start	End	E-Value	Type
PH	6	109	4.81e-16	SMART
S_TKc	148	405	3.53e-106	SMART
S_TK_X	406	475	2.61e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111160
AA Change: I178T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000106790
Gene: ENSMUSG00000019699
AA Change: I178T

Domain	Start	End	E-Value	Type
PH	6	109	4.81e-16	SMART
S_TKc	148	405	3.53e-106	SMART
S_TK_X	406	475	2.61e-17	SMART

Meta Mutation Damage Score

0.9104

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the AKT, also called PKB, serine/threonine protein kinase family. AKT kinases are known to be regulators of cell signaling in response to insulin and growth factors. They are involved in a wide variety of biological processes including cell proliferation, differentiation, apoptosis, tumorigenesis, as well as glycogen synthesis and glucose uptake. This kinase has been shown to be stimulated by platelet-derived growth factor (PDGF), insulin, and insulin-like growth factor 1 (IGF1). Alternatively splice transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a 20% decrease in brain size and have smaller and fewer cells in the brain. Mice heterozygous for an ENU-induced mutation exhibit increased seizures (sporadic and induced) and increased brain weight and size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
3110001I22Rik	T	A	16: 13,677,728	H230Q	probably benign	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Abcc4	C	A	14: 118,611,456	G495C	probably damaging	Het
Abcc4	C	A	14: 118,611,459	V494L	possibly damaging	Het
Acsm4	T	C	7: 119,708,740	Y367H	probably benign	Het
Adam21	A	T	12: 81,559,508	Y493*	probably null	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgre4	T	C	17: 55,791,497	S136P	probably benign	Het
Aff4	T	G	11: 53,372,999	L282R	probably damaging	Het
Ap3m1	T	C	14: 21,041,015	Y174C	probably damaging	Het
Atl1	A	G	12: 69,953,500	E308G	probably benign	Het
Atp8b5	T	G	4: 43,369,688	V942G	probably damaging	Het
B3gntl1	A	G	11: 121,644,525		probably null	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cacna1c	A	T	6: 118,630,322	I1366N	probably benign	Het
Ccdc113	T	A	8: 95,540,831	N141K	probably benign	Het
Ccdc167	T	C	17: 29,704,431	N77D	possibly damaging	Het
Ccser1	T	C	6: 61,313,646		probably benign	Het
Cenpe	A	G	3: 135,242,493	E1230G	probably damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Exog	A	G	9: 119,452,266	E190G	possibly damaging	Het
Fam162b	A	G	10: 51,590,334	W30R	probably benign	Het
Fam172a	C	A	13: 77,902,720	H50N	probably benign	Het
Fndc3b	G	A	3: 27,456,451	Q841*	probably null	Het
Frzb	T	A	2: 80,424,601	Y197F	probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gabrb1	G	A	5: 71,700,336	R43Q	probably benign	Het
Gm21060	A	T	19: 61,297,007	H21Q	possibly damaging	Het
Gm4825	A	G	15: 85,511,044		noncoding transcript	Het
Gm5581	A	C	6: 131,168,162		noncoding transcript	Het
Gm9894	T	C	13: 67,763,915		noncoding transcript	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Gria4	A	T	9: 4,519,546		probably benign	Het
Grid2	T	C	6: 63,908,893	L91S	probably damaging	Het
Igsf5	A	C	16: 96,378,351	T215P	probably damaging	Het
Kif13a	G	A	13: 46,864,838		probably benign	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Kifc2	T	A	15: 76,662,825	L226H	probably damaging	Het
Klf10	T	C	15: 38,295,996	H435R	probably damaging	Het
Masp1	T	C	16: 23,452,932	Y623C	probably damaging	Het
Megf10	T	A	18: 57,212,354	C118S	probably damaging	Het
Mical3	A	G	6: 120,982,607	V909A	possibly damaging	Het
Mmrn2	A	G	14: 34,398,475		probably null	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nmi	A	T	2: 51,948,620	S301T	probably benign	Het
Nr2f2	G	T	7: 70,358,155	T193K	possibly damaging	Het
Ntng2	T	C	2: 29,197,098	N404S	probably damaging	Het
Olfr54	T	G	11: 51,027,475	S158A	probably benign	Het
Olfr594	T	C	7: 103,219,997	V93A	probably benign	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Otoa	T	A	7: 121,118,569	D336E	probably benign	Het
Pde4b	A	G	4: 102,597,460	E108G	probably damaging	Het
Pdgfrb	G	A	18: 61,061,505	R118H	possibly damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Plekhg4	A	G	8: 105,381,464	E982G	probably damaging	Het
Pmfbp1	T	G	8: 109,530,144		probably benign	Het
Pot1b	A	T	17: 55,662,531	Y546N	probably damaging	Het
Rab11fip5	C	A	6: 85,348,991	Q144H	possibly damaging	Het
Reep3	A	T	10: 67,039,499		probably null	Het
Rgl2	T	C	17: 33,933,615	L400P	probably damaging	Het
Rnf122	A	G	8: 31,124,846		probably benign	Het
Scgb1b21	G	T	7: 33,527,378		noncoding transcript	Het
Sec63	A	T	10: 42,823,886	K647N	probably damaging	Het
Sema4a	C	T	3: 88,438,176		probably benign	Het
Serpinf1	C	T	11: 75,416,419	V31I	probably benign	Het
Sez6l	C	T	5: 112,424,615		probably benign	Het
Shank3	T	C	15: 89,557,964	S1612P	possibly damaging	Het
Slc19a3	G	A	1: 83,022,798	T166M	probably benign	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc38a11	A	T	2: 65,330,339	F304I	possibly damaging	Het
Slitrk1	T	A	14: 108,912,190	N363I	probably damaging	Het
Slx4ip	A	G	2: 137,067,681	T129A	probably benign	Het
Spop	T	C	11: 95,491,711	V332A	possibly damaging	Het
Sptlc1	A	C	13: 53,358,880	D147E	probably benign	Het
Tnpo1	T	C	13: 98,852,932	Y754C	probably damaging	Het
Tox	C	A	4: 6,688,886	V493L	probably damaging	Het
Ttbk1	A	C	17: 46,480,224	F45V	probably damaging	Het
Ttc27	T	A	17: 74,780,856	M472K	probably damaging	Het
Ttll7	A	G	3: 146,915,795		probably benign	Het
Ttn	A	T	2: 76,721,760	C22851S	probably benign	Het
Ttn	T	A	2: 76,798,212	M14535L	possibly damaging	Het
Txlna	T	C	4: 129,640,262	T54A	probably benign	Het
Usp33	T	C	3: 152,380,628	V668A	probably damaging	Het
Vmn2r28	C	A	7: 5,481,071	C710F	possibly damaging	Het
Vmn2r8	T	A	5: 108,798,095	M549L	probably benign	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het

Other mutations in Akt3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01020:Akt3	APN	1	177130967	splice site	probably benign
IGL02348:Akt3	APN	1	177059386	missense	probably damaging	0.99
IGL02394:Akt3	APN	1	177059419	missense	probably damaging	1.00
IGL03005:Akt3	APN	1	177067227	missense	probably damaging	1.00
R0114:Akt3	UTSW	1	177067251	missense	probably damaging	1.00
R1403:Akt3	UTSW	1	177131110	splice site	probably benign
R1452:Akt3	UTSW	1	177131067	missense	possibly damaging	0.93
R1495:Akt3	UTSW	1	177103042	missense	probably benign
R2062:Akt3	UTSW	1	177102985	missense	possibly damaging	0.93
R2064:Akt3	UTSW	1	177102985	missense	possibly damaging	0.93
R2066:Akt3	UTSW	1	177102985	missense	possibly damaging	0.93
R2068:Akt3	UTSW	1	177102985	missense	possibly damaging	0.93
R4155:Akt3	UTSW	1	177096977	missense	possibly damaging	0.92
R4937:Akt3	UTSW	1	177050127	missense	possibly damaging	0.89
R5097:Akt3	UTSW	1	177248688	missense	probably benign	0.01
R5414:Akt3	UTSW	1	177050251	missense	probably damaging	0.98
R6336:Akt3	UTSW	1	177031712	missense	probably damaging	1.00
R6723:Akt3	UTSW	1	177050190	nonsense	probably null
R6752:Akt3	UTSW	1	177050190	nonsense	probably null
R6753:Akt3	UTSW	1	177050190	nonsense	probably null
R6755:Akt3	UTSW	1	177050190	nonsense	probably null
R6765:Akt3	UTSW	1	177050190	nonsense	probably null
R6766:Akt3	UTSW	1	177050190	nonsense	probably null
R6767:Akt3	UTSW	1	177050190	nonsense	probably null
R6782:Akt3	UTSW	1	177050190	nonsense	probably null
R6787:Akt3	UTSW	1	177050190	nonsense	probably null
R6847:Akt3	UTSW	1	177031659	missense	probably damaging	1.00
R7525:Akt3	UTSW	1	177020107	nonsense	probably null
R7535:Akt3	UTSW	1	177097034	missense	probably damaging	1.00
R8000:Akt3	UTSW	1	177050197	missense	probably damaging	1.00
R8326:Akt3	UTSW	1	177050045	missense	possibly damaging	0.95
R8947:Akt3	UTSW	1	177131079	missense	probably damaging	1.00
R9047:Akt3	UTSW	1	177059389	missense	probably damaging	0.98
R9474:Akt3	UTSW	1	177025386	missense	probably damaging	1.00
R9564:Akt3	UTSW	1	177080203	missense	possibly damaging	0.47
R9680:Akt3	UTSW	1	177131073	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTCACAAGAGAATAACAGTTTCACC -3'
(R):5'- ATTGGTAGGAACAGTATCAAGTGTATG -3'

Sequencing Primer
(F):5'- CATGGAATACCTATACCGC -3'
(R):5'- TGGTGCAAGTTTATACAGCAAG -3'

Posted On

2015-05-19