Incidental Mutation 'R1961:Sema4a'
ID 317903
Institutional Source Beutler Lab
Gene Symbol Sema4a
Ensembl Gene ENSMUSG00000028064
Gene Name sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A
Synonyms SemB, SemB, Semab
MMRRC Submission 039975-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.902) question?
Stock # R1961 (G1)
Quality Score 216
Status Validated
Chromosome 3
Chromosomal Location 88343266-88368489 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 88345483 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029700] [ENSMUST00000107531] [ENSMUST00000165898] [ENSMUST00000169222] [ENSMUST00000166237]
AlphaFold Q62178
Predicted Effect probably benign
Transcript: ENSMUST00000029700
SMART Domains Protein: ENSMUSP00000029700
Gene: ENSMUSG00000028064

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107531
SMART Domains Protein: ENSMUSP00000103155
Gene: ENSMUSG00000028064

DomainStartEndE-ValueType
Sema 2 346 2.06e-101 SMART
PSI 364 415 9.33e-13 SMART
transmembrane domain 548 570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156108
Predicted Effect probably benign
Transcript: ENSMUST00000165898
SMART Domains Protein: ENSMUSP00000128510
Gene: ENSMUSG00000028064

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169222
SMART Domains Protein: ENSMUSP00000128887
Gene: ENSMUSG00000028064

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166237
SMART Domains Protein: ENSMUSP00000125909
Gene: ENSMUSG00000028064

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183768
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of soluble and transmembrane proteins. Semaphorins are involved in numerous functions, including axon guidance, morphogenesis, carcinogenesis, and immunomodulation. The encoded protein is a single-pass type I membrane protein containing an immunoglobulin-like C2-type domain, a PSI domain and a sema domain. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. It is an activator of T-cell-mediated immunity and suppresses vascular endothelial growth factor (VEGF)-mediated endothelial cell migration and proliferation in vitro and angiogenesis in vivo. Mutations in this gene are associated with retinal degenerative diseases including retinitis pigmentosa type 35 (RP35) and cone-rod dystrophy type 10 (CORD10). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a knock-out allele show no obvious brain defects but exhibit impaired T cell priming and defective Th1 responses. Homozygotes for a gene trap allele show severe retinal degeneration with reduced retinal vessels, depigmentation and dysfunction of both rod and cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,214,257 (GRCm39) Y191H probably damaging Het
Abcc4 C A 14: 118,848,871 (GRCm39) V494L possibly damaging Het
Abcc4 C A 14: 118,848,868 (GRCm39) G495C probably damaging Het
Acsm4 T C 7: 119,307,963 (GRCm39) Y367H probably benign Het
Adam21 A T 12: 81,606,282 (GRCm39) Y493* probably null Het
Add2 T C 6: 86,073,738 (GRCm39) F209S probably damaging Het
Adgre4 T C 17: 56,098,497 (GRCm39) S136P probably benign Het
Aff4 T G 11: 53,263,826 (GRCm39) L282R probably damaging Het
Akt3 A G 1: 176,924,561 (GRCm39) I178T probably damaging Het
Ap3m1 T C 14: 21,091,083 (GRCm39) Y174C probably damaging Het
Arb2a C A 13: 78,050,839 (GRCm39) H50N probably benign Het
Atl1 A G 12: 70,000,274 (GRCm39) E308G probably benign Het
Atp8b5 T G 4: 43,369,688 (GRCm39) V942G probably damaging Het
B3gntl1 A G 11: 121,535,351 (GRCm39) probably null Het
Btrc T G 19: 45,515,782 (GRCm39) I480S probably damaging Het
Cacna1c A T 6: 118,607,283 (GRCm39) I1366N probably benign Het
Ccdc113 T A 8: 96,267,459 (GRCm39) N141K probably benign Het
Ccdc167 T C 17: 29,923,405 (GRCm39) N77D possibly damaging Het
Ccser1 T C 6: 61,290,630 (GRCm39) probably benign Het
Cenpe A G 3: 134,948,254 (GRCm39) E1230G probably damaging Het
Clec12a A C 6: 129,327,444 (GRCm39) T21P possibly damaging Het
Cyp26c1 T A 19: 37,675,825 (GRCm39) F230I probably damaging Het
Exog A G 9: 119,281,332 (GRCm39) E190G possibly damaging Het
Fam162b A G 10: 51,466,430 (GRCm39) W30R probably benign Het
Fndc3b G A 3: 27,510,600 (GRCm39) Q841* probably null Het
Frzb T A 2: 80,254,945 (GRCm39) Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gabrb1 G A 5: 71,857,679 (GRCm39) R43Q probably benign Het
Gm21060 A T 19: 61,285,445 (GRCm39) H21Q possibly damaging Het
Gm4825 A G 15: 85,395,245 (GRCm39) noncoding transcript Het
Gm5581 A C 6: 131,145,125 (GRCm39) noncoding transcript Het
Gm9894 T C 13: 67,912,034 (GRCm39) noncoding transcript Het
Gpr15 T A 16: 58,538,370 (GRCm39) I240L probably benign Het
Gria4 A T 9: 4,519,546 (GRCm39) probably benign Het
Grid2 T C 6: 63,885,877 (GRCm39) L91S probably damaging Het
Igsf5 A C 16: 96,179,551 (GRCm39) T215P probably damaging Het
Kif13a G A 13: 47,018,314 (GRCm39) probably benign Het
Kif21a G A 15: 90,855,051 (GRCm39) A703V probably damaging Het
Kif27 T G 13: 58,440,937 (GRCm39) R1159S probably benign Het
Kifc2 T A 15: 76,547,025 (GRCm39) L226H probably damaging Het
Klf10 T C 15: 38,296,240 (GRCm39) H435R probably damaging Het
Masp1 T C 16: 23,271,682 (GRCm39) Y623C probably damaging Het
Megf10 T A 18: 57,345,426 (GRCm39) C118S probably damaging Het
Mical3 A G 6: 120,959,568 (GRCm39) V909A possibly damaging Het
Mmrn2 A G 14: 34,120,432 (GRCm39) probably null Het
Mpeg1 G A 19: 12,440,275 (GRCm39) V578M probably damaging Het
Nlrp2 T C 7: 5,330,737 (GRCm39) E553G probably damaging Het
Nmi A T 2: 51,838,632 (GRCm39) S301T probably benign Het
Nr2f2 G T 7: 70,007,903 (GRCm39) T193K possibly damaging Het
Ntng2 T C 2: 29,087,110 (GRCm39) N404S probably damaging Het
Nup50l A G 6: 96,142,250 (GRCm39) S265P possibly damaging Het
Oplah G A 15: 76,181,664 (GRCm39) T1119I probably damaging Het
Or1x2 T G 11: 50,918,302 (GRCm39) S158A probably benign Het
Or52e3 T C 7: 102,869,204 (GRCm39) V93A probably benign Het
Otoa T A 7: 120,717,792 (GRCm39) D336E probably benign Het
Pde4b A G 4: 102,454,657 (GRCm39) E108G probably damaging Het
Pdgfrb G A 18: 61,194,577 (GRCm39) R118H possibly damaging Het
Phactr4 G A 4: 132,104,559 (GRCm39) T256I probably benign Het
Pla2g3 C T 11: 3,440,983 (GRCm39) T316I probably benign Het
Plekhg4 A G 8: 106,108,096 (GRCm39) E982G probably damaging Het
Pmfbp1 T G 8: 110,256,776 (GRCm39) probably benign Het
Pot1b A T 17: 55,969,531 (GRCm39) Y546N probably damaging Het
Pphln1-ps1 T A 16: 13,495,592 (GRCm39) H230Q probably benign Het
Rab11fip5 C A 6: 85,325,973 (GRCm39) Q144H possibly damaging Het
Reep3 A T 10: 66,875,278 (GRCm39) probably null Het
Rgl2 T C 17: 34,152,589 (GRCm39) L400P probably damaging Het
Rnf122 A G 8: 31,614,874 (GRCm39) probably benign Het
Scgb1b21 G T 7: 33,226,803 (GRCm39) noncoding transcript Het
Sec63 A T 10: 42,699,882 (GRCm39) K647N probably damaging Het
Serpinf1 C T 11: 75,307,245 (GRCm39) V31I probably benign Het
Sez6l C T 5: 112,572,481 (GRCm39) probably benign Het
Shank3 T C 15: 89,442,167 (GRCm39) S1612P possibly damaging Het
Slc19a3 G A 1: 83,000,519 (GRCm39) T166M probably benign Het
Slc22a29 C A 19: 8,146,557 (GRCm39) R415M probably benign Het
Slc38a11 A T 2: 65,160,683 (GRCm39) F304I possibly damaging Het
Slitrk1 T A 14: 109,149,622 (GRCm39) N363I probably damaging Het
Slx4ip A G 2: 136,909,601 (GRCm39) T129A probably benign Het
Spop T C 11: 95,382,537 (GRCm39) V332A possibly damaging Het
Sptlc1 A C 13: 53,512,916 (GRCm39) D147E probably benign Het
Tnpo1 T C 13: 98,989,440 (GRCm39) Y754C probably damaging Het
Tox C A 4: 6,688,886 (GRCm39) V493L probably damaging Het
Ttbk1 A C 17: 46,791,150 (GRCm39) F45V probably damaging Het
Ttc27 T A 17: 75,087,851 (GRCm39) M472K probably damaging Het
Ttll7 A G 3: 146,621,550 (GRCm39) probably benign Het
Ttn A T 2: 76,552,104 (GRCm39) C22851S probably benign Het
Ttn T A 2: 76,628,556 (GRCm39) M14535L possibly damaging Het
Txlna T C 4: 129,534,055 (GRCm39) T54A probably benign Het
Usp33 T C 3: 152,086,265 (GRCm39) V668A probably damaging Het
Vmn2r28 C A 7: 5,484,070 (GRCm39) C710F possibly damaging Het
Vmn2r8 T A 5: 108,945,961 (GRCm39) M549L probably benign Het
Vwa5b2 T C 16: 20,420,941 (GRCm39) probably null Het
Wnk1 T C 6: 119,946,208 (GRCm39) I648M probably damaging Het
Other mutations in Sema4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Sema4a APN 3 88,357,117 (GRCm39) missense probably damaging 1.00
IGL01722:Sema4a APN 3 88,345,491 (GRCm39) missense probably benign 0.14
IGL01769:Sema4a APN 3 88,357,063 (GRCm39) missense possibly damaging 0.86
IGL02076:Sema4a APN 3 88,357,829 (GRCm39) missense probably damaging 0.99
IGL02202:Sema4a APN 3 88,357,050 (GRCm39) missense probably damaging 1.00
R0145:Sema4a UTSW 3 88,358,729 (GRCm39) missense probably damaging 1.00
R0386:Sema4a UTSW 3 88,344,107 (GRCm39) missense possibly damaging 0.75
R0837:Sema4a UTSW 3 88,360,405 (GRCm39) missense possibly damaging 0.46
R0863:Sema4a UTSW 3 88,355,456 (GRCm39) unclassified probably benign
R1567:Sema4a UTSW 3 88,359,353 (GRCm39) missense probably damaging 1.00
R1675:Sema4a UTSW 3 88,362,073 (GRCm39) missense possibly damaging 0.66
R1739:Sema4a UTSW 3 88,344,145 (GRCm39) missense possibly damaging 0.94
R1801:Sema4a UTSW 3 88,344,056 (GRCm39) missense probably benign 0.04
R2029:Sema4a UTSW 3 88,358,668 (GRCm39) missense probably damaging 1.00
R4934:Sema4a UTSW 3 88,345,568 (GRCm39) missense probably damaging 1.00
R5006:Sema4a UTSW 3 88,344,091 (GRCm39) missense probably benign
R5309:Sema4a UTSW 3 88,344,343 (GRCm39) missense probably damaging 1.00
R5312:Sema4a UTSW 3 88,344,343 (GRCm39) missense probably damaging 1.00
R5338:Sema4a UTSW 3 88,358,804 (GRCm39) missense probably benign 0.01
R5481:Sema4a UTSW 3 88,360,347 (GRCm39) nonsense probably null
R5510:Sema4a UTSW 3 88,357,293 (GRCm39) critical splice donor site probably null
R6046:Sema4a UTSW 3 88,348,008 (GRCm39) missense probably damaging 1.00
R7242:Sema4a UTSW 3 88,357,416 (GRCm39) missense probably damaging 1.00
R8403:Sema4a UTSW 3 88,359,341 (GRCm39) missense probably damaging 0.98
R8798:Sema4a UTSW 3 88,344,004 (GRCm39) missense possibly damaging 0.76
R9328:Sema4a UTSW 3 88,345,613 (GRCm39) nonsense probably null
R9638:Sema4a UTSW 3 88,357,066 (GRCm39) missense probably damaging 1.00
R9728:Sema4a UTSW 3 88,348,187 (GRCm39) critical splice acceptor site probably null
Z1176:Sema4a UTSW 3 88,344,500 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCAAGAGCAGCTTCAAAGC -3'
(R):5'- GGGACCTGAACAGAACACAGTC -3'

Sequencing Primer
(F):5'- TTCAAAGCTGCCCTGAGG -3'
(R):5'- TGCTAGGGCTCCTGACAC -3'
Posted On 2015-05-19