Incidental Mutation 'R4190:Gabra2'
ID319908
Institutional Source Beutler Lab
Gene Symbol Gabra2
Ensembl Gene ENSMUSG00000000560
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 2
SynonymsC630048P16Rik, Gabra-2
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4190 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location70957597-71095849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71007998 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 210 (P210S)
Ref Sequence ENSEMBL: ENSMUSP00000142892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000572] [ENSMUST00000197284] [ENSMUST00000198625]
Predicted Effect probably benign
Transcript: ENSMUST00000000572
SMART Domains Protein: ENSMUSP00000000572
Gene: ENSMUSG00000000560

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Neur_chan_LBD 42 250 1.9e-51 PFAM
Pfam:Neur_chan_memb 257 344 1.2e-32 PFAM
low complexity region 364 375 N/A INTRINSIC
low complexity region 392 410 N/A INTRINSIC
transmembrane domain 423 440 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197124
Predicted Effect probably benign
Transcript: ENSMUST00000197284
AA Change: P210S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142892
Gene: ENSMUSG00000000560
AA Change: P210S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Neur_chan_LBD 42 250 2.7e-53 PFAM
Pfam:Neur_chan_memb 257 354 5.6e-38 PFAM
Pfam:Neur_chan_memb 343 437 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198625
SMART Domains Protein: ENSMUSP00000143645
Gene: ENSMUSG00000000560

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
SCOP:d1i9ba_ 47 87 7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199861
Meta Mutation Damage Score 0.1240 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knockout allele are resistant to the anxiolytic effects of diazepam (DZP). Mice homozygous for a different knock-out allele exhibit reduced DZP-induced antihyperalgesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Gabra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Gabra2 APN 5 70962072 missense probably benign
IGL01084:Gabra2 APN 5 71006233 missense probably damaging 1.00
IGL01948:Gabra2 APN 5 70961885 missense probably damaging 1.00
IGL01965:Gabra2 APN 5 71008075 splice site probably benign
IGL03263:Gabra2 APN 5 70973493 missense probably damaging 1.00
R0005:Gabra2 UTSW 5 70973436 missense probably benign 0.00
R0751:Gabra2 UTSW 5 71092099 splice site probably benign
R1025:Gabra2 UTSW 5 70973595 missense probably damaging 1.00
R1713:Gabra2 UTSW 5 71014563 missense probably benign 0.24
R1964:Gabra2 UTSW 5 71014450 missense possibly damaging 0.91
R3861:Gabra2 UTSW 5 70973543 missense probably damaging 1.00
R4192:Gabra2 UTSW 5 71007998 missense probably benign 0.00
R4193:Gabra2 UTSW 5 71007998 missense probably benign 0.00
R6281:Gabra2 UTSW 5 71034762 missense probably damaging 1.00
R6419:Gabra2 UTSW 5 70962083 missense probably benign 0.00
R6814:Gabra2 UTSW 5 71094539 missense probably damaging 1.00
R6872:Gabra2 UTSW 5 71094539 missense probably damaging 1.00
R8253:Gabra2 UTSW 5 71092070 missense probably benign 0.00
Z1177:Gabra2 UTSW 5 71007992 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GTTTCATTAATCTATAGATCCCAAGGG -3'
(R):5'- AAGTATTTTCATGCTCATGGTTGGC -3'

Sequencing Primer
(F):5'- AATGTTACTGACCTGTACTG -3'
(R):5'- AGGACTTCCTTTCCTCTAAACCTGAG -3'
Posted On2015-06-10