Incidental Mutation 'R4190:Telo2'
ID319935
Institutional Source Beutler Lab
Gene Symbol Telo2
Ensembl Gene ENSMUSG00000024170
Gene Nametelomere maintenance 2
Synonyms1200003M09Rik
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4190 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25099570-25115967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25102013 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 743 (T743A)
Ref Sequence ENSEMBL: ENSMUSP00000110835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000024987] [ENSMUST00000115181]
Predicted Effect probably benign
Transcript: ENSMUST00000024983
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000024987
AA Change: T743A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000024987
Gene: ENSMUSG00000024170
AA Change: T743A

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115181
AA Change: T743A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000110835
Gene: ENSMUSG00000024170
AA Change: T743A

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156698
Meta Mutation Damage Score 0.0793 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as an S-phase checkpoint protein in the cell cycle. The protein may also play a role in DNA repair.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E13.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Telo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Telo2 APN 17 25100129 splice site probably benign
IGL01398:Telo2 APN 17 25105774 missense probably benign 0.00
IGL01878:Telo2 APN 17 25101358 missense probably benign 0.19
IGL02728:Telo2 APN 17 25104654 missense probably damaging 1.00
R0669:Telo2 UTSW 17 25105823 missense probably benign 0.01
R0671:Telo2 UTSW 17 25113165 missense probably benign 0.00
R1783:Telo2 UTSW 17 25102738 splice site probably null
R1869:Telo2 UTSW 17 25114994 missense probably benign 0.32
R1988:Telo2 UTSW 17 25101668 missense probably benign 0.04
R2018:Telo2 UTSW 17 25105408 missense probably damaging 1.00
R2167:Telo2 UTSW 17 25110818 missense probably benign
R2219:Telo2 UTSW 17 25103699 missense probably benign 0.00
R3421:Telo2 UTSW 17 25110752 missense probably damaging 0.99
R3880:Telo2 UTSW 17 25106833 missense probably damaging 1.00
R4299:Telo2 UTSW 17 25115256 missense possibly damaging 0.94
R4574:Telo2 UTSW 17 25101673 missense probably damaging 1.00
R4600:Telo2 UTSW 17 25105148 missense possibly damaging 0.79
R6010:Telo2 UTSW 17 25104878 missense possibly damaging 0.79
R6185:Telo2 UTSW 17 25102040 missense probably benign 0.29
R6513:Telo2 UTSW 17 25101412 missense probably damaging 1.00
R7352:Telo2 UTSW 17 25102069 missense probably damaging 1.00
R7538:Telo2 UTSW 17 25110821 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCATGGAGCTCTGCACAGAC -3'
(R):5'- AAGACTATGTGAGCCTCCAAGG -3'

Sequencing Primer
(F):5'- AGACTGCCCCTAGGGTCAAAG -3'
(R):5'- CCAAGGGTTTGGCTTTCTGTC -3'
Posted On2015-06-10