Incidental Mutation 'R4190:Atf7ip'
ID319911
Institutional Source Beutler Lab
Gene Symbol Atf7ip
Ensembl Gene ENSMUSG00000030213
Gene Nameactivating transcription factor 7 interacting protein
SynonymsMcaf1, 2610204M12Rik, AM, ATFa-associated Modulator
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.882) question?
Stock #R4190 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136506167-136610862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136587501 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 914 (V914A)
Ref Sequence ENSEMBL: ENSMUSP00000140502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032335] [ENSMUST00000187429]
Predicted Effect probably benign
Transcript: ENSMUST00000032335
AA Change: V906A

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213
AA Change: V906A

DomainStartEndE-ValueType
internal_repeat_1 123 144 9.59e-5 PROSPERO
internal_repeat_1 143 164 9.59e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
Pfam:ATF7IP_BD 598 813 5.5e-62 PFAM
low complexity region 864 889 N/A INTRINSIC
PDB:2RPQ|B 974 1017 5e-7 PDB
low complexity region 1022 1036 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1168 1192 N/A INTRINSIC
FN3 1194 1288 3.4e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187429
AA Change: V914A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140502
Gene: ENSMUSG00000030213
AA Change: V914A

DomainStartEndE-ValueType
internal_repeat_1 123 144 8.96e-5 PROSPERO
internal_repeat_1 143 164 8.96e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
coiled coil region 666 696 N/A INTRINSIC
low complexity region 701 711 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 774 803 N/A INTRINSIC
low complexity region 864 889 N/A INTRINSIC
Meta Mutation Damage Score 0.1262 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Atf7ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Atf7ip APN 6 136560681 missense probably benign 0.00
IGL01483:Atf7ip APN 6 136587459 missense probably damaging 1.00
IGL02313:Atf7ip APN 6 136606720 missense probably damaging 0.99
IGL02319:Atf7ip APN 6 136593118 missense probably benign 0.01
IGL02547:Atf7ip APN 6 136603276 splice site probably benign
IGL02869:Atf7ip APN 6 136606579 missense probably damaging 0.99
IGL02895:Atf7ip APN 6 136560688 missense probably damaging 0.99
IGL02967:Atf7ip APN 6 136606727 missense probably damaging 0.98
IGL03026:Atf7ip APN 6 136605382 missense possibly damaging 0.79
R0024:Atf7ip UTSW 6 136599820 splice site probably benign
R0045:Atf7ip UTSW 6 136559816 missense probably damaging 1.00
R0045:Atf7ip UTSW 6 136559816 missense probably damaging 1.00
R0325:Atf7ip UTSW 6 136560989 missense possibly damaging 0.86
R0331:Atf7ip UTSW 6 136561163 missense possibly damaging 0.94
R0415:Atf7ip UTSW 6 136560012 missense possibly damaging 0.92
R0490:Atf7ip UTSW 6 136609192 unclassified probably benign
R0526:Atf7ip UTSW 6 136559805 missense probably damaging 1.00
R1503:Atf7ip UTSW 6 136606867 missense probably damaging 0.96
R1663:Atf7ip UTSW 6 136603324 missense possibly damaging 0.93
R1793:Atf7ip UTSW 6 136609219 unclassified probably benign
R1822:Atf7ip UTSW 6 136587260 missense probably benign 0.11
R1873:Atf7ip UTSW 6 136559888 missense probably damaging 1.00
R1937:Atf7ip UTSW 6 136560780 missense probably benign 0.41
R2059:Atf7ip UTSW 6 136609348 unclassified probably benign
R2134:Atf7ip UTSW 6 136605487 missense possibly damaging 0.80
R2679:Atf7ip UTSW 6 136566651 missense possibly damaging 0.62
R3430:Atf7ip UTSW 6 136575324 unclassified probably benign
R3755:Atf7ip UTSW 6 136560817 missense probably benign 0.01
R3756:Atf7ip UTSW 6 136560817 missense probably benign 0.01
R3890:Atf7ip UTSW 6 136587045 missense possibly damaging 0.48
R4494:Atf7ip UTSW 6 136563749 splice site probably null
R4588:Atf7ip UTSW 6 136599694 missense probably benign
R4618:Atf7ip UTSW 6 136565106 missense probably damaging 1.00
R4705:Atf7ip UTSW 6 136561194 missense probably damaging 1.00
R4838:Atf7ip UTSW 6 136596491 missense probably benign 0.06
R4922:Atf7ip UTSW 6 136560041 missense possibly damaging 0.91
R4956:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R4957:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R4958:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R5000:Atf7ip UTSW 6 136582428 missense probably damaging 1.00
R5001:Atf7ip UTSW 6 136561388 missense probably damaging 0.99
R5075:Atf7ip UTSW 6 136560234 missense probably benign
R5279:Atf7ip UTSW 6 136603379 nonsense probably null
R5445:Atf7ip UTSW 6 136587257 missense probably damaging 1.00
R5844:Atf7ip UTSW 6 136606814 missense probably damaging 1.00
R5850:Atf7ip UTSW 6 136566787 critical splice donor site probably null
R5891:Atf7ip UTSW 6 136559977 missense possibly damaging 0.64
R5987:Atf7ip UTSW 6 136571502 missense probably damaging 1.00
R6168:Atf7ip UTSW 6 136559819 missense probably damaging 1.00
R6726:Atf7ip UTSW 6 136582391 missense probably damaging 1.00
R6880:Atf7ip UTSW 6 136561040 missense probably damaging 1.00
R6924:Atf7ip UTSW 6 136559757 splice site probably null
R7075:Atf7ip UTSW 6 136596515 critical splice donor site probably null
R7308:Atf7ip UTSW 6 136565089 missense probably benign 0.01
R7365:Atf7ip UTSW 6 136560710 missense probably benign
R7556:Atf7ip UTSW 6 136561241 missense probably damaging 0.99
R7812:Atf7ip UTSW 6 136603417 missense probably damaging 0.96
R8032:Atf7ip UTSW 6 136565112 missense probably benign 0.00
R8203:Atf7ip UTSW 6 136606783 missense probably damaging 0.99
R8274:Atf7ip UTSW 6 136560990 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCAAAGTCATCCAGGGAC -3'
(R):5'- CAATTCTTGGGGTGGCAGAG -3'

Sequencing Primer
(F):5'- AGTCATCCAGGGACTTTAGTGACC -3'
(R):5'- CAGAGCTATTTTGTTCTGCTGAAG -3'
Posted On2015-06-10