Incidental Mutation 'R4190:Olfr770'
ID319925
Institutional Source Beutler Lab
Gene Symbol Olfr770
Ensembl Gene ENSMUSG00000047868
Gene Nameolfactory receptor 770
SynonymsMOR114-5, GA_x6K02T2PULF-10819232-10818297
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4190 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129132578-129138998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129132967 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 267 (N267S)
Ref Sequence ENSEMBL: ENSMUSP00000144960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062314] [ENSMUST00000203887] [ENSMUST00000204250] [ENSMUST00000204712]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062314
AA Change: N267S

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055193
Gene: ENSMUSG00000047868
AA Change: N267S

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.2e-43 PFAM
Pfam:7tm_1 38 286 5.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203887
AA Change: N267S

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144950
Gene: ENSMUSG00000047868
AA Change: N267S

DomainStartEndE-ValueType
Pfam:7tm_4 28 107 1.5e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204250
AA Change: N267S

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144892
Gene: ENSMUSG00000047868
AA Change: N267S

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.2e-43 PFAM
Pfam:7tm_1 38 286 5.5e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204712
AA Change: N267S

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144960
Gene: ENSMUSG00000047868
AA Change: N267S

DomainStartEndE-ValueType
Pfam:7tm_4 28 130 1.4e-17 PFAM
Pfam:7TM_GPCR_Srsx 32 130 2.4e-4 PFAM
Pfam:7tm_1 38 130 8.8e-16 PFAM
Meta Mutation Damage Score 0.1583 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Olfr770
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0787:Olfr770 UTSW 10 129133526 missense possibly damaging 0.89
R2141:Olfr770 UTSW 10 129133006 missense probably benign 0.23
R4397:Olfr770 UTSW 10 129133581 missense possibly damaging 0.59
R5009:Olfr770 UTSW 10 129133615 missense probably benign 0.06
R5781:Olfr770 UTSW 10 129133147 missense probably damaging 1.00
R6343:Olfr770 UTSW 10 129133666 nonsense probably null
R7492:Olfr770 UTSW 10 129133640 missense probably damaging 0.99
R7530:Olfr770 UTSW 10 129133980 intron probably null
Z1088:Olfr770 UTSW 10 129133075 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TAGAGAAGGCTTGGACCACC -3'
(R):5'- ACATGGGTCATTGAGCAGATG -3'

Sequencing Primer
(F):5'- GAAGGCCTGTTTGACTTG -3'
(R):5'- ATAGGATGTGCCGTGCTGACC -3'
Posted On2015-06-10