Incidental Mutation 'R4279:Ccl25'
ID322803
Institutional Source Beutler Lab
Gene Symbol Ccl25
Ensembl Gene ENSMUSG00000023235
Gene Namechemokine (C-C motif) ligand 25
SynonymsCKb15, Scya25, TECK
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location4325210-4360020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4349829 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 56 (L56Q)
Ref Sequence ENSEMBL: ENSMUSP00000117515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024004] [ENSMUST00000069762] [ENSMUST00000098949] [ENSMUST00000110982] [ENSMUST00000127460] [ENSMUST00000136191] [ENSMUST00000155797]
Predicted Effect probably damaging
Transcript: ENSMUST00000024004
AA Change: L3Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024004
Gene: ENSMUSG00000023235
AA Change: L3Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCY 27 88 1.34e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069762
Predicted Effect probably benign
Transcript: ENSMUST00000098949
Predicted Effect possibly damaging
Transcript: ENSMUST00000110982
AA Change: L3Q

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106610
Gene: ENSMUSG00000023235
AA Change: L3Q

DomainStartEndE-ValueType
SCY 27 88 1.34e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127460
AA Change: L87Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120719
Gene: ENSMUSG00000023235
AA Change: L87Q

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
SCY 111 172 1.34e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136191
AA Change: L56Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117515
Gene: ENSMUSG00000023235
AA Change: L56Q

DomainStartEndE-ValueType
Pfam:IL8 23 66 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155797
Meta Mutation Damage Score 0.6655 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired accumulation of antigen-specific CD8+ T lymphocytes within both lamina propria and epithelium of the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Unc13a T C 8: 71,666,667 K9R probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Ccl25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Ccl25 APN 8 4348700 intron probably benign
IGL02188:Ccl25 APN 8 4348552 intron probably benign
IGL03338:Ccl25 APN 8 4349898 intron probably benign
R0584:Ccl25 UTSW 8 4354085 splice site probably benign
R0613:Ccl25 UTSW 8 4349850 missense probably benign 0.42
R1208:Ccl25 UTSW 8 4357631 missense possibly damaging 0.92
R1208:Ccl25 UTSW 8 4357631 missense possibly damaging 0.92
R1413:Ccl25 UTSW 8 4353892 makesense probably null
R3844:Ccl25 UTSW 8 4354183 missense possibly damaging 0.86
R4921:Ccl25 UTSW 8 4353913 missense possibly damaging 0.92
R7021:Ccl25 UTSW 8 4349641 intron probably benign
R7033:Ccl25 UTSW 8 4349641 intron probably benign
R7630:Ccl25 UTSW 8 4353955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGACCAGAAAGGCATTG -3'
(R):5'- GTTATGCCCAACCTCCCAAGAG -3'

Sequencing Primer
(F):5'- CAGAAAGGCATTGGTGAGTCTTTTTC -3'
(R):5'- TCCCAAGAGACACTGAAGAGTTC -3'
Posted On2015-06-20