Incidental Mutation 'R4279:Unc13a'
ID322804
Institutional Source Beutler Lab
Gene Symbol Unc13a
Ensembl Gene ENSMUSG00000034799
Gene Nameunc-13 homolog A (C. elegans)
Synonyms2410078G03Rik, Munc13-1
MMRRC Submission 041079-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4279 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71624417-71671757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71666667 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 9 (K9R)
Ref Sequence ENSEMBL: ENSMUSP00000135189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000177517]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030170
AA Change: K9R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: K9R

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176777
Predicted Effect probably damaging
Transcript: ENSMUST00000177517
AA Change: K9R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: K9R

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.7e-53 PFAM
C2 1574 1680 5.03e-12 SMART
Meta Mutation Damage Score 0.0961 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 T A 15: 96,371,756 L1250Q probably damaging Het
Ccdc73 A T 2: 104,985,010 N364Y possibly damaging Het
Ccl25 T A 8: 4,349,829 L56Q probably damaging Het
Ctnnd2 C A 15: 30,905,820 A871E probably damaging Het
Cyp2b23 C T 7: 26,666,027 S461N possibly damaging Het
Dgat2 C A 7: 99,164,705 G120V probably damaging Het
Dsp A T 13: 38,185,231 I768F probably damaging Het
Dzank1 T C 2: 144,491,845 E356G probably benign Het
Fam120a A T 13: 48,889,258 V889D probably benign Het
Fxyd5 C A 7: 31,035,386 D139Y probably null Het
Gcnt2 T C 13: 40,888,190 V275A probably benign Het
Gimap4 A G 6: 48,690,577 I89V probably benign Het
Gm6578 G A 6: 12,100,188 noncoding transcript Het
Jmjd8 A G 17: 25,829,813 probably benign Het
Jmy G C 13: 93,498,882 P142R probably damaging Het
Jmy C A 13: 93,499,273 D12Y probably damaging Het
Kif13b G T 14: 64,779,356 A1324S probably damaging Het
Klhl31 T C 9: 77,655,839 S629P unknown Het
Lpar1 A G 4: 58,487,115 V52A possibly damaging Het
Lrp5 A G 19: 3,591,778 S1395P possibly damaging Het
Mogs T C 6: 83,116,067 L132P probably damaging Het
Ncam1 C A 9: 49,506,959 probably benign Het
Ndufs8 A T 19: 3,911,014 F88I probably damaging Het
Nos2 T A 11: 78,929,776 L69Q probably benign Het
Olfr575 T A 7: 102,955,085 Q179L probably benign Het
Pls3 A T X: 75,802,532 I192N probably benign Het
Psmd6 T C 14: 14,112,297 N388S possibly damaging Het
Rrbp1 T C 2: 143,963,108 T1046A probably benign Het
Scn11a T C 9: 119,754,362 E1729G probably benign Het
Slc6a3 A G 13: 73,544,834 D191G possibly damaging Het
Slc9a1 T C 4: 133,412,089 F206S probably benign Het
Tmc5 A G 7: 118,674,663 *968W probably null Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vegfa A G 17: 46,031,466 V142A probably benign Het
Vmn1r119 T A 7: 21,011,861 M199L probably benign Het
Vnn1 A T 10: 23,898,512 D151V possibly damaging Het
Zfp365 A T 10: 67,897,601 F254I probably benign Het
Other mutations in Unc13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Unc13a APN 8 71643147 missense probably null 0.70
IGL01023:Unc13a APN 8 71661825 missense probably benign 0.02
IGL01456:Unc13a APN 8 71644567 missense probably damaging 1.00
IGL01820:Unc13a APN 8 71654947 missense probably damaging 0.99
IGL01909:Unc13a APN 8 71639210 splice site probably benign
IGL01925:Unc13a APN 8 71634543 missense possibly damaging 0.95
IGL02407:Unc13a APN 8 71648942 missense probably damaging 0.99
IGL02622:Unc13a APN 8 71652514 splice site probably null
IGL02634:Unc13a APN 8 71655701 missense probably benign 0.03
IGL02724:Unc13a APN 8 71656305 splice site probably benign
IGL02892:Unc13a APN 8 71649910 missense probably damaging 1.00
IGL02948:Unc13a APN 8 71650549 missense possibly damaging 0.63
IGL03081:Unc13a APN 8 71649549 missense probably damaging 0.98
IGL03372:Unc13a APN 8 71655709 missense probably damaging 1.00
curvy UTSW 8 71630504 splice site probably null
Greed UTSW 8 71654845 missense probably damaging 1.00
largesse UTSW 8 71634658 missense probably damaging 1.00
serpiginous UTSW 8 71664245 missense probably damaging 1.00
PIT4469001:Unc13a UTSW 8 71658314 nonsense probably null
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0389:Unc13a UTSW 8 71658032 missense probably benign 0.01
R0457:Unc13a UTSW 8 71658001 critical splice donor site probably null
R0478:Unc13a UTSW 8 71651148 missense possibly damaging 0.92
R0483:Unc13a UTSW 8 71644913 missense probably damaging 0.96
R0609:Unc13a UTSW 8 71658467 missense probably damaging 0.96
R0611:Unc13a UTSW 8 71649865 missense probably damaging 1.00
R0730:Unc13a UTSW 8 71656285 missense possibly damaging 0.68
R0883:Unc13a UTSW 8 71642173 nonsense probably null
R1162:Unc13a UTSW 8 71647917 missense probably benign 0.31
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1196:Unc13a UTSW 8 71654986 missense probably damaging 1.00
R1400:Unc13a UTSW 8 71651221 missense probably damaging 1.00
R1446:Unc13a UTSW 8 71648981 missense possibly damaging 0.91
R1507:Unc13a UTSW 8 71658266 missense probably benign
R1636:Unc13a UTSW 8 71653390 missense probably damaging 1.00
R1858:Unc13a UTSW 8 71652399 missense probably damaging 1.00
R2025:Unc13a UTSW 8 71639768 missense possibly damaging 0.92
R2107:Unc13a UTSW 8 71656251 splice site probably null
R2286:Unc13a UTSW 8 71630559 missense probably damaging 1.00
R2334:Unc13a UTSW 8 71634558 missense probably damaging 1.00
R2924:Unc13a UTSW 8 71644952 missense possibly damaging 0.88
R3177:Unc13a UTSW 8 71629695 missense probably benign 0.01
R3277:Unc13a UTSW 8 71629695 missense probably benign 0.01
R4175:Unc13a UTSW 8 71667724 intron probably benign
R4629:Unc13a UTSW 8 71653453 missense possibly damaging 0.65
R4803:Unc13a UTSW 8 71662850 splice site probably null
R4877:Unc13a UTSW 8 71658616 missense possibly damaging 0.85
R4927:Unc13a UTSW 8 71654845 missense probably damaging 1.00
R4930:Unc13a UTSW 8 71630504 splice site probably null
R4994:Unc13a UTSW 8 71643172 missense probably benign 0.28
R5011:Unc13a UTSW 8 71641477 nonsense probably null
R5252:Unc13a UTSW 8 71652564 missense probably damaging 1.00
R5356:Unc13a UTSW 8 71662514 missense probably benign 0.02
R5458:Unc13a UTSW 8 71664245 missense probably damaging 1.00
R5514:Unc13a UTSW 8 71643151 missense probably damaging 1.00
R5784:Unc13a UTSW 8 71655666 missense possibly damaging 0.61
R5853:Unc13a UTSW 8 71655129 splice site probably null
R6183:Unc13a UTSW 8 71644666 missense probably damaging 1.00
R6277:Unc13a UTSW 8 71666639 critical splice donor site probably null
R6374:Unc13a UTSW 8 71641453 missense possibly damaging 0.70
R6392:Unc13a UTSW 8 71637809 missense possibly damaging 0.83
R6515:Unc13a UTSW 8 71647940 missense probably benign 0.44
R6576:Unc13a UTSW 8 71653478 missense probably benign 0.00
R6943:Unc13a UTSW 8 71652377 missense probably damaging 1.00
R7045:Unc13a UTSW 8 71658763 missense possibly damaging 0.95
R7062:Unc13a UTSW 8 71663237 missense probably benign 0.00
R7146:Unc13a UTSW 8 71630553 missense probably damaging 1.00
R7260:Unc13a UTSW 8 71660585 missense possibly damaging 0.71
R7443:Unc13a UTSW 8 71630959 missense probably damaging 0.98
R7545:Unc13a UTSW 8 71641509 critical splice acceptor site probably null
R7644:Unc13a UTSW 8 71634538 missense probably benign 0.13
R7780:Unc13a UTSW 8 71658335 missense probably benign 0.02
Z1088:Unc13a UTSW 8 71654803 critical splice donor site probably null
Z1177:Unc13a UTSW 8 71644872 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTCACACCTAAGATGAACCTG -3'
(R):5'- TATTTGAGATGGGGTCAAGAGC -3'

Sequencing Primer
(F):5'- TAAGATGAACCTGCCCTCTGC -3'
(R):5'- CTCTGCGGCTCTCTGATGG -3'
Posted On2015-06-20