Mutagenetix > Incidental Mutations

Incidental Mutation 'R6183:Unc13a'

487628

Institutional Source

Beutler Lab

Gene Symbol

Unc13a

Ensembl Gene

ENSMUSG00000034799

Gene Name

unc-13 homolog A (C. elegans)

Synonyms

2410078G03Rik, Munc13-1

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6183 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71624417-71671757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 71644666 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1195 (S1195T)

Ref Sequence

ENSEMBL: ENSMUSP00000030170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000177517]

AlphaFold

Q4KUS2

Predicted Effect

probably damaging
Transcript: ENSMUST00000030170
AA Change: S1195T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: S1195T

Domain	Start	End	E-Value	Type
C2	3	94	5.23e-10	SMART
low complexity region	187	202	N/A	INTRINSIC
low complexity region	264	277	N/A	INTRINSIC
low complexity region	299	310	N/A	INTRINSIC
coiled coil region	321	359	N/A	INTRINSIC
low complexity region	412	430	N/A	INTRINSIC
low complexity region	435	450	N/A	INTRINSIC
PDB:2KDU\|B	454	488	3e-16	PDB
C1	563	612	3.93e-18	SMART
C2	686	793	5.86e-22	SMART
DUF1041	1002	1111	1.6e-56	SMART
Pfam:Membr_traf_MHD	1355	1520	6.3e-53	PFAM
C2	1555	1661	5.03e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175909

Predicted Effect

unknown
Transcript: ENSMUST00000176127
AA Change: S104T

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177032

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177517
AA Change: S1195T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: S1195T

Domain	Start	End	E-Value	Type
C2	3	94	5.23e-10	SMART
low complexity region	187	202	N/A	INTRINSIC
low complexity region	264	277	N/A	INTRINSIC
low complexity region	299	310	N/A	INTRINSIC
coiled coil region	321	359	N/A	INTRINSIC
low complexity region	412	430	N/A	INTRINSIC
low complexity region	435	450	N/A	INTRINSIC
PDB:2KDU\|B	454	488	3e-16	PDB
C1	563	612	3.93e-18	SMART
C2	686	793	5.86e-22	SMART
DUF1041	1002	1111	1.6e-56	SMART
Pfam:Membr_traf_MHD	1355	1520	6.7e-53	PFAM
C2	1574	1680	5.03e-12	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	C	5: 31,487,976	Y358H	probably damaging	Het
5830411N06Rik	A	G	7: 140,296,034	T404A	possibly damaging	Het
Abcb4	T	A	5: 8,918,718	D352E	probably benign	Het
Adgrb3	T	A	1: 25,094,370	I972L	probably damaging	Het
Alg3	T	C	16: 20,610,641	Y33C	probably benign	Het
Atp1a3	C	T	7: 24,981,752	G816D	probably damaging	Het
Ces1g	C	T	8: 93,331,239	V145M	possibly damaging	Het
Clip1	A	G	5: 123,642,604	S339P	probably damaging	Het
Col2a1	G	T	15: 97,988,790	T378N	unknown	Het
Dennd4b	ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG	ACAGCAGCAGCAGCAGCAGCAGCAGCAG	3: 90,275,568		probably benign	Het
Dnah12	T	A	14: 26,861,769	L3207Q	probably damaging	Het
Efcab5	T	C	11: 77,137,258	T416A	probably benign	Het
Ephb1	A	T	9: 102,195,325	I85N	probably damaging	Het
Etnppl	T	C	3: 130,620,317	C22R	probably damaging	Het
F830016B08Rik	A	G	18: 60,299,877	T11A	probably benign	Het
Gm5458	C	A	14: 19,599,644	V171L	probably damaging	Het
Helb	G	T	10: 120,112,998		probably null	Het
Hnrnpll	A	G	17: 80,049,876	V237A	possibly damaging	Het
Hps3	T	C	3: 20,008,868	T712A	probably benign	Het
Ibsp	A	G	5: 104,306,030	E78G	possibly damaging	Het
Ighv1-62-2	G	A	12: 115,446,436	A111V	probably damaging	Het
Igkv4-63	G	T	6: 69,378,124	Q58K	probably damaging	Het
Iqcg	T	C	16: 33,030,923	Y226C	probably damaging	Het
Khdc1a	A	T	1: 21,350,108	D30V	possibly damaging	Het
Krtap5-5	C	A	7: 142,229,787	C42F	unknown	Het
Lmod3	T	C	6: 97,252,553	N7D	probably damaging	Het
Lvrn	A	G	18: 46,850,685	N165S	probably benign	Het
Ms4a4c	A	G	19: 11,426,229	T192A	possibly damaging	Het
Ncald	A	T	15: 37,397,232	V68D	probably damaging	Het
Olfr1507	T	A	14: 52,490,731	T78S	probably benign	Het
Pcdhgb7	A	T	18: 37,752,262	I162F	probably damaging	Het
Prokr1	T	C	6: 87,588,852	T4A	possibly damaging	Het
Qrich2	T	A	11: 116,458,129		probably benign	Het
Rgl1	C	T	1: 152,586,570	E60K	possibly damaging	Het
Rtn1	A	T	12: 72,408,491	W21R	probably benign	Het
Spast	A	G	17: 74,373,358	I438M	probably damaging	Het
Sptbn5	C	T	2: 120,059,417		probably benign	Het
Sry	C	G	Y: 2,662,975	Q228H	unknown	Het
Tas1r1	A	G	4: 152,032,541	I212T	probably damaging	Het
Tbc1d1	A	G	5: 64,275,425	N439D	probably damaging	Het
Tjp2	C	T	19: 24,100,791	A913T	probably damaging	Het
Tnfrsf26	A	G	7: 143,611,757	L47P	probably damaging	Het
Usp54	T	C	14: 20,552,245	R1346G	probably damaging	Het
Vmn1r54	T	A	6: 90,269,290	M62K	possibly damaging	Het
Vmn2r125	A	T	4: 156,350,069	D50V	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Vmn2r95	T	A	17: 18,443,930	N470K	probably damaging	Het
Zc3h7a	A	T	16: 11,147,370	I633N	possibly damaging	Het

Other mutations in Unc13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Unc13a	APN	8	71643147	missense	probably null	0.70
IGL01023:Unc13a	APN	8	71661825	missense	probably benign	0.02
IGL01456:Unc13a	APN	8	71644567	missense	probably damaging	1.00
IGL01820:Unc13a	APN	8	71654947	missense	probably damaging	0.99
IGL01909:Unc13a	APN	8	71639210	splice site	probably benign
IGL01925:Unc13a	APN	8	71634543	missense	possibly damaging	0.95
IGL02407:Unc13a	APN	8	71648942	missense	probably damaging	0.99
IGL02622:Unc13a	APN	8	71652514	splice site	probably null
IGL02634:Unc13a	APN	8	71655701	missense	probably benign	0.03
IGL02724:Unc13a	APN	8	71656305	splice site	probably benign
IGL02892:Unc13a	APN	8	71649910	missense	probably damaging	1.00
IGL02948:Unc13a	APN	8	71650549	missense	possibly damaging	0.63
IGL03081:Unc13a	APN	8	71649549	missense	probably damaging	0.98
IGL03372:Unc13a	APN	8	71655709	missense	probably damaging	1.00
curvy	UTSW	8	71630504	splice site	probably null
Greed	UTSW	8	71654845	missense	probably damaging	1.00
largesse	UTSW	8	71634658	missense	probably damaging	1.00
serpiginous	UTSW	8	71664245	missense	probably damaging	1.00
PIT4469001:Unc13a	UTSW	8	71658314	nonsense	probably null
R0067:Unc13a	UTSW	8	71634658	missense	probably damaging	1.00
R0067:Unc13a	UTSW	8	71634658	missense	probably damaging	1.00
R0389:Unc13a	UTSW	8	71658032	missense	probably benign	0.01
R0457:Unc13a	UTSW	8	71658001	critical splice donor site	probably null
R0478:Unc13a	UTSW	8	71651148	missense	possibly damaging	0.92
R0483:Unc13a	UTSW	8	71644913	missense	probably damaging	0.96
R0609:Unc13a	UTSW	8	71658467	missense	probably damaging	0.96
R0611:Unc13a	UTSW	8	71649865	missense	probably damaging	1.00
R0730:Unc13a	UTSW	8	71656285	missense	possibly damaging	0.68
R0883:Unc13a	UTSW	8	71642173	nonsense	probably null
R1162:Unc13a	UTSW	8	71647917	missense	probably benign	0.31
R1185:Unc13a	UTSW	8	71661833	missense	probably benign	0.13
R1185:Unc13a	UTSW	8	71661833	missense	probably benign	0.13
R1185:Unc13a	UTSW	8	71661833	missense	probably benign	0.13
R1196:Unc13a	UTSW	8	71654986	missense	probably damaging	1.00
R1400:Unc13a	UTSW	8	71651221	missense	probably damaging	1.00
R1446:Unc13a	UTSW	8	71648981	missense	possibly damaging	0.91
R1507:Unc13a	UTSW	8	71658266	missense	probably benign
R1636:Unc13a	UTSW	8	71653390	missense	probably damaging	1.00
R1858:Unc13a	UTSW	8	71652399	missense	probably damaging	1.00
R2025:Unc13a	UTSW	8	71639768	missense	possibly damaging	0.92
R2107:Unc13a	UTSW	8	71656251	splice site	probably null
R2286:Unc13a	UTSW	8	71630559	missense	probably damaging	1.00
R2334:Unc13a	UTSW	8	71634558	missense	probably damaging	1.00
R2924:Unc13a	UTSW	8	71644952	missense	possibly damaging	0.88
R3177:Unc13a	UTSW	8	71629695	missense	probably benign	0.01
R3277:Unc13a	UTSW	8	71629695	missense	probably benign	0.01
R4175:Unc13a	UTSW	8	71667724	intron	probably benign
R4279:Unc13a	UTSW	8	71666667	missense	probably damaging	0.98
R4629:Unc13a	UTSW	8	71653453	missense	possibly damaging	0.65
R4803:Unc13a	UTSW	8	71662850	splice site	probably null
R4877:Unc13a	UTSW	8	71658616	missense	possibly damaging	0.85
R4927:Unc13a	UTSW	8	71654845	missense	probably damaging	1.00
R4930:Unc13a	UTSW	8	71630504	splice site	probably null
R4994:Unc13a	UTSW	8	71643172	missense	probably benign	0.28
R5011:Unc13a	UTSW	8	71641477	nonsense	probably null
R5252:Unc13a	UTSW	8	71652564	missense	probably damaging	1.00
R5356:Unc13a	UTSW	8	71662514	missense	probably benign	0.02
R5458:Unc13a	UTSW	8	71664245	missense	probably damaging	1.00
R5514:Unc13a	UTSW	8	71643151	missense	probably damaging	1.00
R5784:Unc13a	UTSW	8	71655666	missense	possibly damaging	0.61
R5853:Unc13a	UTSW	8	71655129	splice site	probably null
R6277:Unc13a	UTSW	8	71666639	critical splice donor site	probably null
R6374:Unc13a	UTSW	8	71641453	missense	possibly damaging	0.70
R6392:Unc13a	UTSW	8	71637809	missense	possibly damaging	0.83
R6515:Unc13a	UTSW	8	71647940	missense	probably benign	0.44
R6576:Unc13a	UTSW	8	71653478	missense	probably benign	0.00
R6943:Unc13a	UTSW	8	71652377	missense	probably damaging	1.00
R7045:Unc13a	UTSW	8	71658763	missense	possibly damaging	0.95
R7062:Unc13a	UTSW	8	71663237	missense	probably benign	0.00
R7146:Unc13a	UTSW	8	71630553	missense	probably damaging	1.00
R7260:Unc13a	UTSW	8	71660585	missense	possibly damaging	0.71
R7443:Unc13a	UTSW	8	71630959	missense	probably damaging	0.98
R7545:Unc13a	UTSW	8	71641509	critical splice acceptor site	probably null
R7644:Unc13a	UTSW	8	71634538	missense	probably benign	0.13
R7780:Unc13a	UTSW	8	71658335	missense	probably benign	0.02
R7952:Unc13a	UTSW	8	71658487	missense	possibly damaging	0.71
R7989:Unc13a	UTSW	8	71652273	missense	probably damaging	1.00
R8169:Unc13a	UTSW	8	71656289	missense	probably damaging	1.00
R8503:Unc13a	UTSW	8	71645761	missense	possibly damaging	0.67
R8504:Unc13a	UTSW	8	71645761	missense	possibly damaging	0.67
R8675:Unc13a	UTSW	8	71645715	missense	probably benign	0.00
R8929:Unc13a	UTSW	8	71651191	missense	probably benign	0.01
R8945:Unc13a	UTSW	8	71647953	missense	probably damaging	0.99
R8979:Unc13a	UTSW	8	71660481	missense	probably benign	0.07
R9109:Unc13a	UTSW	8	71655691	missense	possibly damaging	0.65
R9136:Unc13a	UTSW	8	71652350	missense	possibly damaging	0.93
R9235:Unc13a	UTSW	8	71663268	missense	probably benign
R9298:Unc13a	UTSW	8	71655691	missense	possibly damaging	0.65
R9355:Unc13a	UTSW	8	71645731	missense	possibly damaging	0.67
Z1088:Unc13a	UTSW	8	71654803	critical splice donor site	probably null
Z1177:Unc13a	UTSW	8	71644872	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTGACTTCATCTGCAGTGGC -3'
(R):5'- CCTTCGTCATCCAGTGGTTG -3'

Sequencing Primer
(F):5'- CTCTGTCATCCAACTGAATACCATG -3'
(R):5'- GGACTTCCTGCATGGTGC -3'

Posted On

2017-10-10