Incidental Mutation 'R4275:Camsap2'
ID324741
Institutional Source Beutler Lab
Gene Symbol Camsap2
Ensembl Gene ENSMUSG00000041570
Gene Namecalmodulin regulated spectrin-associated protein family, member 2
Synonyms1600013L13Rik, Camsap1l1, 4930541M15Rik
MMRRC Submission 041646-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.730) question?
Stock #R4275 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136268123-136346104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136270876 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1462 (V1462A)
Ref Sequence ENSEMBL: ENSMUSP00000142299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048309] [ENSMUST00000192001] [ENSMUST00000192314]
Predicted Effect probably benign
Transcript: ENSMUST00000048309
AA Change: V1468A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000041920
Gene: ENSMUSG00000041570
AA Change: V1468A

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 239 322 3.6e-37 PFAM
low complexity region 379 388 N/A INTRINSIC
low complexity region 397 410 N/A INTRINSIC
low complexity region 483 491 N/A INTRINSIC
low complexity region 671 690 N/A INTRINSIC
low complexity region 706 711 N/A INTRINSIC
Pfam:CAMSAP_CC1 738 795 7.3e-28 PFAM
coiled coil region 878 916 N/A INTRINSIC
low complexity region 922 929 N/A INTRINSIC
low complexity region 943 956 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
coiled coil region 1155 1227 N/A INTRINSIC
low complexity region 1242 1256 N/A INTRINSIC
CAMSAP_CKK 1337 1466 1.59e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181385
Predicted Effect probably benign
Transcript: ENSMUST00000192001
AA Change: V1451A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142166
Gene: ENSMUSG00000041570
AA Change: V1451A

DomainStartEndE-ValueType
Pfam:CH 178 324 1.1e-37 PFAM
Pfam:CAMSAP_CH 222 305 2.7e-36 PFAM
low complexity region 362 371 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
low complexity region 466 474 N/A INTRINSIC
low complexity region 654 673 N/A INTRINSIC
low complexity region 689 694 N/A INTRINSIC
coiled coil region 729 767 N/A INTRINSIC
coiled coil region 861 899 N/A INTRINSIC
low complexity region 905 912 N/A INTRINSIC
low complexity region 926 939 N/A INTRINSIC
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
coiled coil region 1138 1210 N/A INTRINSIC
low complexity region 1225 1239 N/A INTRINSIC
CAMSAP_CKK 1320 1449 1.59e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192314
AA Change: V1462A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142299
Gene: ENSMUSG00000041570
AA Change: V1462A

DomainStartEndE-ValueType
Pfam:CH 178 335 1.2e-35 PFAM
Pfam:CAMSAP_CH 233 316 3.2e-34 PFAM
low complexity region 373 382 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 477 485 N/A INTRINSIC
low complexity region 665 684 N/A INTRINSIC
low complexity region 700 705 N/A INTRINSIC
coiled coil region 740 778 N/A INTRINSIC
coiled coil region 872 910 N/A INTRINSIC
low complexity region 916 923 N/A INTRINSIC
low complexity region 937 950 N/A INTRINSIC
low complexity region 1022 1037 N/A INTRINSIC
low complexity region 1087 1101 N/A INTRINSIC
coiled coil region 1149 1221 N/A INTRINSIC
low complexity region 1236 1250 N/A INTRINSIC
CAMSAP_CKK 1331 1460 1.2e-90 SMART
Predicted Effect unknown
Transcript: ENSMUST00000194808
AA Change: V803A
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1e T C 1: 154,493,325 Y322C probably damaging Het
D3Ertd751e C A 3: 41,756,154 probably benign Het
Dhcr7 C T 7: 143,843,227 A152V probably damaging Het
Enpep A T 3: 129,332,278 N68K probably benign Het
Fam126b T C 1: 58,529,933 T440A probably benign Het
Fam131b G A 6: 42,321,307 L43F probably damaging Het
Fbxl5 T A 5: 43,762,772 probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igf2 T C 7: 142,655,786 M46V probably benign Het
Kntc1 T A 5: 123,767,779 Y367N probably damaging Het
Mapk8ip2 T C 15: 89,458,995 W647R probably damaging Het
Mettl21c C T 1: 44,010,556 V110I probably damaging Het
Mrgprh T C 17: 12,877,227 L118P probably damaging Het
Myadm A G 7: 3,297,102 T127A probably benign Het
Myh10 A T 11: 68,751,940 probably null Het
Nadk T A 4: 155,584,255 Y128N probably benign Het
Olfr1089 T C 2: 86,733,592 T7A probably damaging Het
Olfr996 T C 2: 85,579,863 V208A probably benign Het
Papolg A G 11: 23,868,378 I500T probably benign Het
Pkhd1 A T 1: 20,058,384 C4032S probably benign Het
Rnase1 A T 14: 51,145,870 L9Q probably damaging Het
Rspry1 G T 8: 94,649,761 V304L probably benign Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Scpep1 T C 11: 88,947,142 probably null Het
Serpina3m T A 12: 104,389,116 I14N probably damaging Het
Smg6 A C 11: 74,993,874 probably benign Het
Suz12 T C 11: 80,030,053 M593T probably damaging Het
Tmem139 A G 6: 42,264,105 E208G probably damaging Het
Tnxb A G 17: 34,698,231 Y2200C probably damaging Het
Usp19 T G 9: 108,498,694 V911G probably damaging Het
Vipr1 T C 9: 121,664,618 L245P probably damaging Het
Vmn2r105 T A 17: 20,228,640 I92F probably damaging Het
Zfp518b A G 5: 38,671,728 V978A probably damaging Het
Zfp651 T A 9: 121,766,539 V576D probably damaging Het
Other mutations in Camsap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Camsap2 APN 1 136297790 missense probably benign 0.23
IGL02727:Camsap2 APN 1 136304312 missense probably benign
IGL02803:Camsap2 APN 1 136281123 missense probably damaging 1.00
IGL03037:Camsap2 APN 1 136274857 missense probably damaging 1.00
IGL03124:Camsap2 APN 1 136274799 critical splice donor site probably null
IGL03189:Camsap2 APN 1 136281662 missense probably damaging 1.00
IGL03297:Camsap2 APN 1 136297801 missense probably benign
IGL03347:Camsap2 APN 1 136280986 missense possibly damaging 0.52
ANU23:Camsap2 UTSW 1 136297790 missense probably benign 0.23
PIT4366001:Camsap2 UTSW 1 136280317 missense
R0001:Camsap2 UTSW 1 136282888 unclassified probably benign
R0037:Camsap2 UTSW 1 136281892 missense probably damaging 1.00
R0140:Camsap2 UTSW 1 136280382 missense probably benign
R0194:Camsap2 UTSW 1 136292948 nonsense probably null
R0206:Camsap2 UTSW 1 136281000 missense probably damaging 1.00
R0208:Camsap2 UTSW 1 136281000 missense probably damaging 1.00
R0517:Camsap2 UTSW 1 136293388 missense possibly damaging 0.95
R0648:Camsap2 UTSW 1 136304319 missense probably damaging 0.96
R0735:Camsap2 UTSW 1 136292888 missense probably damaging 1.00
R0790:Camsap2 UTSW 1 136273737 splice site probably benign
R0880:Camsap2 UTSW 1 136280970 missense probably benign 0.08
R1559:Camsap2 UTSW 1 136282094 missense probably benign 0.02
R1728:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1729:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1730:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1739:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1762:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1783:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1784:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1785:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1823:Camsap2 UTSW 1 136273783 missense possibly damaging 0.65
R1824:Camsap2 UTSW 1 136273783 missense possibly damaging 0.65
R1997:Camsap2 UTSW 1 136271545 missense probably damaging 1.00
R2010:Camsap2 UTSW 1 136274868 missense probably damaging 1.00
R2237:Camsap2 UTSW 1 136345331 missense probably damaging 1.00
R2923:Camsap2 UTSW 1 136280809 missense possibly damaging 0.95
R4371:Camsap2 UTSW 1 136287963 missense probably damaging 1.00
R4976:Camsap2 UTSW 1 136304386 missense probably damaging 1.00
R5227:Camsap2 UTSW 1 136274891 intron probably benign
R5513:Camsap2 UTSW 1 136280863 missense probably benign 0.23
R5755:Camsap2 UTSW 1 136282327 missense probably damaging 1.00
R5834:Camsap2 UTSW 1 136280388 missense probably benign
R5966:Camsap2 UTSW 1 136276592 missense probably damaging 1.00
R6031:Camsap2 UTSW 1 136280438 missense possibly damaging 0.46
R6031:Camsap2 UTSW 1 136280438 missense possibly damaging 0.46
R6111:Camsap2 UTSW 1 136281298 missense probably benign
R6147:Camsap2 UTSW 1 136345400 missense probably damaging 1.00
R6284:Camsap2 UTSW 1 136304437 missense possibly damaging 0.63
R6293:Camsap2 UTSW 1 136287920 missense probably damaging 1.00
R6306:Camsap2 UTSW 1 136281199 missense probably benign
R6403:Camsap2 UTSW 1 136280800 nonsense probably null
R6410:Camsap2 UTSW 1 136345444 start gained probably benign
R6943:Camsap2 UTSW 1 136304449 missense probably damaging 1.00
R7268:Camsap2 UTSW 1 136273745 splice site probably null
R7448:Camsap2 UTSW 1 136270906 missense
R7472:Camsap2 UTSW 1 136281393 missense probably damaging 0.96
R7478:Camsap2 UTSW 1 136270940 missense
R7515:Camsap2 UTSW 1 136345370 missense probably damaging 0.99
R7691:Camsap2 UTSW 1 136293004 missense probably damaging 0.99
R7800:Camsap2 UTSW 1 136281901 missense probably damaging 0.99
R8040:Camsap2 UTSW 1 136281247 missense
X0018:Camsap2 UTSW 1 136276575 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTCGGCATTCCAAACACTG -3'
(R):5'- TATACTTACTGCCCAGAAACTGAAG -3'

Sequencing Primer
(F):5'- TCGGCATTCCAAACACTGTGATTAC -3'
(R):5'- TTACTGCCCAGAAACTGAAGAAATC -3'
Posted On2015-06-24