Incidental Mutation 'R4449:Twsg1'
ID328907
Institutional Source Beutler Lab
Gene Symbol Twsg1
Ensembl Gene ENSMUSG00000024098
Gene Nametwisted gastrulation BMP signaling modulator 1
Synonyms1810013J15Rik, D17Ertd403e, 9030422N06Rik, Tsg
MMRRC Submission 041710-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R4449 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location65923066-65951187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65926310 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 215 (V215G)
Ref Sequence ENSEMBL: ENSMUSP00000024906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024906]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024906
AA Change: V215G

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024906
Gene: ENSMUSG00000024098
AA Change: V215G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tsg 85 221 3.6e-49 PFAM
Meta Mutation Damage Score 0.1249 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Homozygous null mice appear healthy at birth, but more than half of the progeny fail to thrive and exhibit dwarfism with delayed ossification and immune system. These defects result in premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgap3 A T 15: 83,334,558 Y105N probably damaging Het
Arid3b T A 9: 57,798,121 K266* probably null Het
Bend3 A G 10: 43,512,083 E824G possibly damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Cadm1 T A 9: 47,813,988 probably benign Het
Cadm1 C T 9: 47,530,437 A22V possibly damaging Het
Cntrob C A 11: 69,305,549 D687Y probably benign Het
Dap3 A T 3: 88,949,878 probably benign Het
Ddc T C 11: 11,835,802 D295G probably damaging Het
Fut10 T A 8: 31,236,257 Y347N probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Helz T C 11: 107,604,163 V321A probably benign Het
Hnrnpul1 T C 7: 25,722,284 probably benign Het
Hsdl2 T A 4: 59,617,692 I353K possibly damaging Het
Igkv3-2 G A 6: 70,698,841 A45T probably benign Het
Kcnh6 A G 11: 106,018,936 Y429C probably damaging Het
Luzp1 T A 4: 136,540,863 N132K probably damaging Het
Mlycd T A 8: 119,410,405 Y455N probably damaging Het
Myl7 C T 11: 5,897,354 D115N probably damaging Het
Olfr593 A T 7: 103,212,480 I196F probably benign Het
Pcdh7 A G 5: 57,720,485 T461A probably damaging Het
Pi4kb C T 3: 94,984,735 S254L probably benign Het
Pitpnc1 A G 11: 107,216,709 V257A probably benign Het
Prpf40b A G 15: 99,314,663 D596G probably damaging Het
Rngtt T C 4: 33,330,865 F156S probably damaging Het
Sema3c A G 5: 17,576,846 probably benign Het
Shisa6 T C 11: 66,525,418 T183A probably benign Het
Skint3 T A 4: 112,270,009 V287E possibly damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc17a3 A T 13: 23,856,732 S392C probably damaging Het
Snx14 T C 9: 88,422,999 I81V probably benign Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Trappc12 A T 12: 28,747,235 D99E probably benign Het
Trim34b T C 7: 104,335,728 C318R probably benign Het
Ttc39a T C 4: 109,442,303 I449T possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ubr1 A G 2: 120,946,381 V293A possibly damaging Het
Unk G A 11: 116,053,634 G404S probably damaging Het
Virma T C 4: 11,498,828 probably null Het
Vps13b T C 15: 35,876,793 V2864A possibly damaging Het
Wdfy4 T A 14: 33,096,083 R1492W probably damaging Het
Zcchc3 G C 2: 152,414,722 P19R probably benign Het
Other mutations in Twsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Twsg1 APN 17 65948651 splice site probably benign
IGL01313:Twsg1 APN 17 65948704 missense probably damaging 1.00
IGL01752:Twsg1 APN 17 65929784 missense probably benign 0.04
IGL02326:Twsg1 APN 17 65926436 missense possibly damaging 0.75
PIT4791001:Twsg1 UTSW 17 65929711 missense probably benign 0.03
R3983:Twsg1 UTSW 17 65929763 missense probably benign 0.20
R4328:Twsg1 UTSW 17 65948738 missense probably benign
R4447:Twsg1 UTSW 17 65929787 missense possibly damaging 0.58
R4625:Twsg1 UTSW 17 65929551 missense probably benign 0.00
R6597:Twsg1 UTSW 17 65937804 missense probably damaging 0.99
R7265:Twsg1 UTSW 17 65929787 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TGTCAGGTTTTCCCAGGACTCC -3'
(R):5'- TGCATTTCAGAGCGCATGTG -3'

Sequencing Primer
(F):5'- TCCCGATCCTCATGTGACTAAAG -3'
(R):5'- TTTCAGAGCGCATGTGCACAG -3'
Posted On2015-07-21