Incidental Mutation 'R4518:Carns1'
ID334094
Institutional Source Beutler Lab
Gene Symbol Carns1
Ensembl Gene ENSMUSG00000075289
Gene Namecarnosine synthase 1
SynonymsAtpgd1
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4518 (G1)
Quality Score146
Status Validated
Chromosome19
Chromosomal Location4164324-4175479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 4170070 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 389 (T389P)
Ref Sequence ENSEMBL: ENSMUSP00000131624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167055]
Predicted Effect probably benign
Transcript: ENSMUST00000167055
AA Change: T389P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131624
Gene: ENSMUSG00000075289
AA Change: T389P

DomainStartEndE-ValueType
low complexity region 206 217 N/A INTRINSIC
low complexity region 312 328 N/A INTRINSIC
low complexity region 332 348 N/A INTRINSIC
low complexity region 399 410 N/A INTRINSIC
low complexity region 414 433 N/A INTRINSIC
low complexity region 490 496 N/A INTRINSIC
Pfam:ATP-grasp_4 620 819 4.1e-46 PFAM
low complexity region 862 875 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181211
Meta Mutation Damage Score 0.0891 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CARNS1 (EC 6.3.2.11), a member of the ATP-grasp family of ATPases, catalyzes the formation of carnosine (beta-alanyl-L-histidine) and homocarnosine (gamma-aminobutyryl-L-histidine), which are found mainly in skeletal muscle and the central nervous system, respectively (Drozak et al., 2010 [PubMed 20097752]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Trmt1l C T 1: 151,448,343 Q314* probably null Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Carns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Carns1 APN 19 4166499 splice site probably null
IGL02246:Carns1 APN 19 4166432 missense possibly damaging 0.87
IGL02658:Carns1 APN 19 4173084 missense probably benign 0.01
IGL02800:Carns1 APN 19 4166570 splice site probably benign
R1750:Carns1 UTSW 19 4173157 missense possibly damaging 0.63
R1902:Carns1 UTSW 19 4166338 missense probably damaging 1.00
R1935:Carns1 UTSW 19 4165474 missense probably damaging 1.00
R2434:Carns1 UTSW 19 4165449 missense probably damaging 1.00
R2437:Carns1 UTSW 19 4165783 missense possibly damaging 0.69
R3772:Carns1 UTSW 19 4170916 splice site probably benign
R4091:Carns1 UTSW 19 4171683 missense probably damaging 0.96
R4668:Carns1 UTSW 19 4165476 nonsense probably null
R4737:Carns1 UTSW 19 4170928 intron probably benign
R4751:Carns1 UTSW 19 4166418 missense probably damaging 1.00
R5384:Carns1 UTSW 19 4171901 critical splice acceptor site probably null
R6077:Carns1 UTSW 19 4170876 missense probably benign 0.01
R6373:Carns1 UTSW 19 4166516 missense probably benign 0.41
R6411:Carns1 UTSW 19 4166464 missense probably damaging 1.00
R6470:Carns1 UTSW 19 4171783 missense possibly damaging 0.85
R6486:Carns1 UTSW 19 4169980 missense probably benign 0.04
R6915:Carns1 UTSW 19 4169913 missense probably benign 0.34
R6981:Carns1 UTSW 19 4170082 missense probably benign 0.00
R7936:Carns1 UTSW 19 4166153 missense probably benign
R8025:Carns1 UTSW 19 4166506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATGCGCGGAATGAGCTTC -3'
(R):5'- AAGGGTTCTTGAAGTGCAGG -3'

Sequencing Primer
(F):5'- GGAATGAGCTTCCCACAACC -3'
(R):5'- TTCTTGAAGTGCAGGGAAGG -3'
Posted On2015-08-18