Incidental Mutation 'R4518:Trmt1l'
ID334044
Institutional Source Beutler Lab
Gene Symbol Trmt1l
Ensembl Gene ENSMUSG00000053286
Gene NametRNA methyltransferase 1 like
SynonymsTrm1-like, 1190005F20Rik
MMRRC Submission 041762-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4518 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location151428542-151458161 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 151448343 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 314 (Q314*)
Ref Sequence ENSEMBL: ENSMUSP00000068309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655]
Predicted Effect probably null
Transcript: ENSMUST00000065625
AA Change: Q314*
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: Q314*

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188843
Predicted Effect probably benign
Transcript: ENSMUST00000189655
SMART Domains Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

DomainStartEndE-ValueType
ZnF_C2H2 28 50 1.1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192826
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082J24Rik T A 5: 30,106,008 probably null Het
Abr A G 11: 76,472,518 S167P possibly damaging Het
Adamtsl2 T C 2: 27,095,547 L481P probably benign Het
Atp8b3 C T 10: 80,523,847 M984I probably benign Het
Brip1 G A 11: 86,077,878 A827V possibly damaging Het
Carns1 T G 19: 4,170,070 T389P probably benign Het
Ccdc88a T C 11: 29,482,651 I1219T probably benign Het
Cckar T C 5: 53,699,922 N311S probably damaging Het
Cenpc1 A G 5: 86,047,587 S108P possibly damaging Het
Chpf G T 1: 75,475,045 S588R probably damaging Het
Clca3a2 T A 3: 144,808,705 T414S probably damaging Het
Cntrl A G 2: 35,148,974 E1092G probably damaging Het
Crb2 C A 2: 37,790,389 T443K probably damaging Het
Cwf19l1 A G 19: 44,133,034 V25A probably damaging Het
Cyb561d1 T C 3: 108,199,571 I111V possibly damaging Het
Dbn1 A T 13: 55,476,229 I350N possibly damaging Het
Dnajb4 T C 3: 152,185,176 I329V probably benign Het
Dnmt1 G T 9: 20,911,978 D1055E probably benign Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam168a C T 7: 100,834,040 A176V probably damaging Het
Farp2 A G 1: 93,620,641 E1016G probably benign Het
Fibcd1 A T 2: 31,817,195 V350E probably damaging Het
Galnt3 C A 2: 66,093,610 R438L probably damaging Het
Golga4 T A 9: 118,559,008 S1733T probably benign Het
Golgb1 G A 16: 36,929,263 E3076K probably damaging Het
Grm7 A G 6: 110,914,546 probably null Het
Hcn2 T C 10: 79,724,702 V289A probably benign Het
Hipk1 G T 3: 103,750,372 H799N probably damaging Het
Ispd G A 12: 36,473,180 V203I possibly damaging Het
Klf14 A G 6: 30,957,932 S256P possibly damaging Het
Muc6 T A 7: 141,644,222 T1214S probably benign Het
Nlrp2 T A 7: 5,325,056 D666V possibly damaging Het
Ntng1 A G 3: 109,935,013 I148T probably damaging Het
Olfr1277 T C 2: 111,269,918 M150V probably benign Het
Olfr39 A G 9: 20,286,250 I184V probably benign Het
Olfr845 T A 9: 19,339,260 S267T possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pacs2 A G 12: 113,060,669 D360G probably benign Het
Parp8 C A 13: 116,895,673 L321F possibly damaging Het
Pdss2 T A 10: 43,372,150 S217T probably damaging Het
Plekhn1 T C 4: 156,225,531 S109G probably damaging Het
Ppil2 A T 16: 17,096,041 F173I possibly damaging Het
Prlr C A 15: 10,328,999 T520K possibly damaging Het
Prokr2 T A 2: 132,374,092 probably null Het
Rab3gap2 G A 1: 185,267,068 V991I probably benign Het
Reln T C 5: 21,901,743 I3210V probably benign Het
Rims2 T C 15: 39,437,526 Y218H probably damaging Het
Slc41a1 T C 1: 131,839,125 V127A probably damaging Het
St8sia6 T A 2: 13,792,751 probably null Het
Tlr6 A G 5: 64,954,904 F220S possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vnn3 G A 10: 23,867,226 V445M possibly damaging Het
Zfhx4 T C 3: 5,412,518 C3398R probably damaging Het
Zfyve16 T C 13: 92,521,312 E697G possibly damaging Het
Other mutations in Trmt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Trmt1l APN 1 151442712 critical splice donor site probably null
IGL02175:Trmt1l APN 1 151448484 missense probably benign 0.00
IGL02348:Trmt1l APN 1 151450006 missense probably damaging 1.00
IGL02397:Trmt1l APN 1 151439531 missense probably damaging 1.00
IGL02582:Trmt1l APN 1 151433785 splice site probably benign
IGL03150:Trmt1l APN 1 151453892 missense probably benign 0.00
IGL03220:Trmt1l APN 1 151440941 splice site probably benign
Canyonlands UTSW 1 151454048 nonsense probably null
IGL03014:Trmt1l UTSW 1 151457930 missense probably damaging 0.99
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0240:Trmt1l UTSW 1 151457454 unclassified probably benign
R0267:Trmt1l UTSW 1 151457675 unclassified probably benign
R2084:Trmt1l UTSW 1 151440854 missense probably damaging 1.00
R2206:Trmt1l UTSW 1 151435843 critical splice donor site probably null
R2338:Trmt1l UTSW 1 151428959 intron probably benign
R2408:Trmt1l UTSW 1 151439516 missense possibly damaging 0.48
R2429:Trmt1l UTSW 1 151433830 missense probably damaging 1.00
R2520:Trmt1l UTSW 1 151453945 missense probably benign 0.14
R3972:Trmt1l UTSW 1 151433883 missense possibly damaging 0.91
R4092:Trmt1l UTSW 1 151455033 missense probably benign 0.18
R4361:Trmt1l UTSW 1 151435875 intron probably benign
R4411:Trmt1l UTSW 1 151452154 missense probably benign 0.02
R4419:Trmt1l UTSW 1 151440808 missense probably damaging 0.98
R4614:Trmt1l UTSW 1 151454048 nonsense probably null
R4617:Trmt1l UTSW 1 151454048 nonsense probably null
R4618:Trmt1l UTSW 1 151454048 nonsense probably null
R4647:Trmt1l UTSW 1 151457881 missense possibly damaging 0.86
R4653:Trmt1l UTSW 1 151439569 missense probably benign 0.00
R4734:Trmt1l UTSW 1 151442637 missense probably benign 0.32
R4873:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R4875:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R5026:Trmt1l UTSW 1 151440876 missense probably damaging 1.00
R5528:Trmt1l UTSW 1 151454995 missense probably benign
R5587:Trmt1l UTSW 1 151435704 intron probably benign
R5872:Trmt1l UTSW 1 151440843 missense probably damaging 1.00
R6060:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
R6169:Trmt1l UTSW 1 151428953 intron probably benign
R6333:Trmt1l UTSW 1 151453934 missense probably benign 0.15
R6906:Trmt1l UTSW 1 151452175 missense probably benign 0.03
R7269:Trmt1l UTSW 1 151457788 missense possibly damaging 0.81
R7574:Trmt1l UTSW 1 151440840 missense possibly damaging 0.95
R7740:Trmt1l UTSW 1 151440888 missense possibly damaging 0.47
R7760:Trmt1l UTSW 1 151442674 missense possibly damaging 0.93
R7984:Trmt1l UTSW 1 151435738 missense probably benign 0.02
R8257:Trmt1l UTSW 1 151428878 start codon destroyed probably null
R8286:Trmt1l UTSW 1 151457792 missense probably damaging 1.00
R8439:Trmt1l UTSW 1 151449976 missense probably benign 0.10
R8451:Trmt1l UTSW 1 151448288 missense unknown
R8514:Trmt1l UTSW 1 151453991 missense probably damaging 0.98
X0039:Trmt1l UTSW 1 151454990 missense possibly damaging 0.88
Z1176:Trmt1l UTSW 1 151453113 missense possibly damaging 0.72
Z1187:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
Z1189:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
Z1190:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
Z1192:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGTACAGAGAAGTGCACGTGTG -3'
(R):5'- CATCGGCAGATCTGTTTCGTG -3'

Sequencing Primer
(F):5'- GTGTTGCTTATAAGACACTTGCC -3'
(R):5'- CAGATCTGTTTCGTGGGTATCTGAC -3'
Posted On2015-08-18