Incidental Mutation 'R4521:Cdc20b'
List |< first << previous [record 6 of 42] next >> last >|
ID334237
Institutional Source Beutler Lab
Gene Symbol Cdc20b
Ensembl Gene ENSMUSG00000078926
Gene Namecell division cycle 20B
SynonymsEG622422, EG238896
MMRRC Submission 041764-MU
Accession Numbers

Genbank: XM_138861

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location113035111-113091195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113081191 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 381 (I381M)
Ref Sequence ENSEMBL: ENSMUSP00000137849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109244] [ENSMUST00000181117] [ENSMUST00000181568]
Predicted Effect probably damaging
Transcript: ENSMUST00000109244
AA Change: I381M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104867
Gene: ENSMUSG00000078926
AA Change: I381M

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 517 2.01e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181117
AA Change: I381M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137915
Gene: ENSMUSG00000078926
AA Change: I381M

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 513 1.78e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181568
AA Change: I381M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137849
Gene: ENSMUSG00000078926
AA Change: I381M

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 431 475 2.01e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232584
Meta Mutation Damage Score 0.4371 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Cdc20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Cdc20b APN 13 113059785 missense possibly damaging 0.74
IGL02603:Cdc20b APN 13 113078755 missense possibly damaging 0.88
IGL02663:Cdc20b APN 13 113056131 critical splice donor site probably null
IGL03024:Cdc20b APN 13 113091042 missense possibly damaging 0.58
IGL03379:Cdc20b APN 13 113081202 missense probably damaging 1.00
H8930:Cdc20b UTSW 13 113083966 missense probably damaging 1.00
R0207:Cdc20b UTSW 13 113078612 missense probably damaging 1.00
R0347:Cdc20b UTSW 13 113059827 missense probably damaging 0.97
R0448:Cdc20b UTSW 13 113078657 missense probably damaging 1.00
R0499:Cdc20b UTSW 13 113055950 missense probably benign 0.00
R1573:Cdc20b UTSW 13 113055944 missense probably benign 0.26
R1651:Cdc20b UTSW 13 113078724 nonsense probably null
R1786:Cdc20b UTSW 13 113081134 missense probably damaging 1.00
R1929:Cdc20b UTSW 13 113071917 missense probably benign 0.07
R2118:Cdc20b UTSW 13 113078698 missense probably benign 0.30
R3436:Cdc20b UTSW 13 113078699 missense probably damaging 0.99
R3508:Cdc20b UTSW 13 113081042 missense possibly damaging 0.80
R3837:Cdc20b UTSW 13 113084008 missense probably damaging 1.00
R4050:Cdc20b UTSW 13 113064285 missense probably benign
R4786:Cdc20b UTSW 13 113078734 missense probably damaging 1.00
R6079:Cdc20b UTSW 13 113084042 missense probably damaging 1.00
R6610:Cdc20b UTSW 13 113064262 missense probably benign 0.02
R6814:Cdc20b UTSW 13 113083975 missense probably damaging 1.00
R6872:Cdc20b UTSW 13 113083975 missense probably damaging 1.00
R6887:Cdc20b UTSW 13 113078653 missense possibly damaging 0.88
R7144:Cdc20b UTSW 13 113083371 missense probably benign 0.36
R7579:Cdc20b UTSW 13 113037048 splice site probably null
R7770:Cdc20b UTSW 13 113078659 missense probably benign 0.01
U15987:Cdc20b UTSW 13 113084042 missense probably damaging 1.00
X0064:Cdc20b UTSW 13 113059742 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TCTTCCTCTCTAACTCAGTGGG -3'
(R):5'- AATCCCAGCTAGCTCTCACT -3'

Sequencing Primer
(F):5'- CTCTAACTCAGTGGGTCCAGATTG -3'
(R):5'- GAGAGGGTCTCACTAAATTGCCC -3'
Posted On2015-08-18