Incidental Mutation 'R4610:Ankle1'
ID 344616
Institutional Source Beutler Lab
Gene Symbol Ankle1
Ensembl Gene ENSMUSG00000046295
Gene Name ankyrin repeat and LEM domain containing 1
Synonyms 8430438L13Rik, Ankrd41
MMRRC Submission 041821-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.293) question?
Stock # R4610 (G1)
Quality Score 217
Status Validated
Chromosome 8
Chromosomal Location 71406010-71409904 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) AT to A at 71407207 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002473] [ENSMUST00000119976] [ENSMUST00000120725]
AlphaFold A8VU90
Predicted Effect probably benign
Transcript: ENSMUST00000002473
SMART Domains Protein: ENSMUSP00000002473
Gene: ENSMUSG00000031820

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 321 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119976
SMART Domains Protein: ENSMUSP00000113162
Gene: ENSMUSG00000046295

DomainStartEndE-ValueType
ANK 6 35 7.52e2 SMART
ANK 39 71 4.01e0 SMART
ANK 75 104 2.37e-2 SMART
ANK 108 139 1.99e2 SMART
low complexity region 177 193 N/A INTRINSIC
Pfam:LEM 282 319 4.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120725
SMART Domains Protein: ENSMUSP00000112797
Gene: ENSMUSG00000046295

DomainStartEndE-ValueType
ANK 6 35 7.52e2 SMART
ANK 39 71 4.01e0 SMART
ANK 75 104 2.37e-2 SMART
ANK 108 139 1.99e2 SMART
low complexity region 157 173 N/A INTRINSIC
Pfam:LEM 261 300 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212383
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes no overt phenotype or detectable defects in hematopoiesis. Mouse embryonic fibroblasts do not show an impaired DNA damage response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,516,921 (GRCm38) D555E probably damaging Het
Adgre1 C A 17: 57,450,073 (GRCm38) Q777K possibly damaging Het
Agpat4 G A 17: 12,210,377 (GRCm38) probably null Het
Ak7 G A 12: 105,713,575 (GRCm38) V123M probably benign Het
Ankrd44 T G 1: 54,766,748 (GRCm38) probably benign Het
Aprt A T 8: 122,575,415 (GRCm38) probably null Het
Aptx T C 4: 40,702,766 (GRCm38) probably null Het
Arsi G A 18: 60,916,651 (GRCm38) G202E probably benign Het
AY358078 T A 14: 51,826,075 (GRCm38) C393S possibly damaging Het
Bbip1 T C 19: 53,932,175 (GRCm38) M1V probably null Het
Cacng7 T A 7: 3,336,691 (GRCm38) M36K probably benign Het
Camta1 A G 4: 151,084,827 (GRCm38) W156R probably damaging Het
Casd1 G A 6: 4,631,165 (GRCm38) probably null Het
Casz1 T A 4: 148,933,267 (GRCm38) Y338N probably damaging Het
Ccdc66 T C 14: 27,500,420 (GRCm38) N122S probably damaging Het
Celf2 G T 2: 6,586,020 (GRCm38) N279K possibly damaging Het
Cfap96 A T 8: 45,970,468 (GRCm38) I69N probably damaging Het
Cit A G 5: 115,994,087 (GRCm38) T1801A probably benign Het
Cnot2 A G 10: 116,499,418 (GRCm38) I275T probably damaging Het
Ddx4 T C 13: 112,612,060 (GRCm38) K435E probably damaging Het
Dnajc6 T C 4: 101,611,264 (GRCm38) F166L probably damaging Het
Dst T C 1: 34,169,856 (GRCm38) L820P probably damaging Het
Dusp11 T A 6: 85,950,055 (GRCm38) N193Y probably damaging Het
Eif1ad7 T C 12: 88,271,774 (GRCm38) N72S probably benign Het
Eif3m A T 2: 105,013,288 (GRCm38) N116K probably benign Het
Epb41l1 A T 2: 156,509,261 (GRCm38) E418D possibly damaging Het
Esyt2 T G 12: 116,318,890 (GRCm38) N153K probably damaging Het
Exoc6b T G 6: 85,003,159 (GRCm38) probably benign Het
Ezr C T 17: 6,739,722 (GRCm38) E502K possibly damaging Het
Fbxw11 T A 11: 32,711,859 (GRCm38) Y66N possibly damaging Het
Frem2 A G 3: 53,547,807 (GRCm38) L2116S possibly damaging Het
Fry T C 5: 150,386,104 (GRCm38) L671P probably damaging Het
Galnt7 A G 8: 57,545,769 (GRCm38) I262T probably damaging Het
Glp1r T C 17: 30,931,247 (GRCm38) F381S probably benign Het
Gm3867 T C 9: 36,257,271 (GRCm38) noncoding transcript Het
Gm8741 G T 17: 35,336,086 (GRCm38) noncoding transcript Het
Golgb1 A G 16: 36,918,625 (GRCm38) D2442G probably damaging Het
Gp1bb A T 16: 18,621,143 (GRCm38) L67Q probably damaging Het
Gstm7 G A 3: 107,926,919 (GRCm38) T206I possibly damaging Het
H2bc7 A T 13: 23,574,057 (GRCm38) V45E possibly damaging Het
Hs3st5 A T 10: 36,828,806 (GRCm38) D35V probably benign Het
Hspa13 T C 16: 75,761,302 (GRCm38) H125R probably benign Het
Hspa1a T G 17: 34,971,180 (GRCm38) H249P probably damaging Het
Igkv10-95 A T 6: 68,680,578 (GRCm38) Q6L probably damaging Het
Il1rap T A 16: 26,714,776 (GRCm38) L474H probably benign Het
Ipo11 T A 13: 106,879,737 (GRCm38) Y489F probably benign Het
Itga5 A G 15: 103,350,832 (GRCm38) Y723H probably damaging Het
Itih2 T C 2: 10,105,160 (GRCm38) N594S probably damaging Het
Itk T A 11: 46,336,515 (GRCm38) Q427L probably benign Het
Kif26b A G 1: 178,679,355 (GRCm38) Y332C probably damaging Het
Kmt2c G A 5: 25,354,384 (GRCm38) R1086W probably damaging Het
Ktn1 T A 14: 47,726,179 (GRCm38) probably benign Het
Lars2 T A 9: 123,418,693 (GRCm38) I305N probably damaging Het
Lgmn G T 12: 102,400,124 (GRCm38) probably benign Het
Ltbp4 C T 7: 27,306,700 (GRCm38) E1453K probably damaging Het
Lypd8 G A 11: 58,386,849 (GRCm38) M152I probably benign Het
Man2a1 T A 17: 64,712,459 (GRCm38) S773T probably benign Het
Map2k6 T G 11: 110,499,474 (GRCm38) L278R probably damaging Het
Mbtps1 A T 8: 119,535,347 (GRCm38) D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 (GRCm38) V60M probably damaging Het
Mical3 C A 6: 120,934,838 (GRCm38) E1083* probably null Het
Mms19 A G 19: 41,945,496 (GRCm38) V811A possibly damaging Het
Mrc2 G A 11: 105,348,431 (GRCm38) probably null Het
Mslnl G A 17: 25,742,934 (GRCm38) V128M probably damaging Het
Mtcl1 T A 17: 66,377,887 (GRCm38) H520L probably benign Het
Mymk A T 2: 27,062,707 (GRCm38) F130I probably damaging Het
Myo1f C T 17: 33,582,332 (GRCm38) R333C probably damaging Het
Myo9a T A 9: 59,871,882 (GRCm38) H1640Q probably benign Het
Nav1 A G 1: 135,592,448 (GRCm38) probably benign Het
Ncbp3 G T 11: 73,079,018 (GRCm38) G564C probably damaging Het
Ncoa4 A T 14: 32,176,725 (GRCm38) I501L probably benign Het
Ngp T A 9: 110,420,815 (GRCm38) N60K possibly damaging Het
Npc1l1 G T 11: 6,228,215 (GRCm38) D398E probably damaging Het
Nphs2 T A 1: 156,326,131 (GRCm38) M264K probably damaging Het
Or4s2b T G 2: 88,678,179 (GRCm38) V101G probably benign Het
Or4s2b G A 2: 88,677,896 (GRCm38) V14I probably benign Het
Or7e165 T A 9: 19,783,146 (GRCm38) Y4* probably null Het
Or8b8 T A 9: 37,898,326 (GRCm38) S307R probably benign Het
Patz1 A G 11: 3,306,241 (GRCm38) Y509C probably damaging Het
Pax8 G A 2: 24,421,583 (GRCm38) P447S probably damaging Het
Pde11a A G 2: 76,158,333 (GRCm38) V488A probably benign Het
Pex11g C T 8: 3,465,899 (GRCm38) V45M probably benign Het
Pik3ip1 T A 11: 3,333,327 (GRCm38) S142R probably damaging Het
Pitpnm2 C G 5: 124,125,371 (GRCm38) A819P probably damaging Het
Pla2g4e T G 2: 120,186,382 (GRCm38) H226P possibly damaging Het
Plin4 T A 17: 56,105,418 (GRCm38) M538L probably benign Het
Ppp3cb T C 14: 20,520,646 (GRCm38) N339S possibly damaging Het
Rev1 T C 1: 38,053,649 (GRCm38) E1202G probably damaging Het
Rngtt T A 4: 33,339,133 (GRCm38) probably benign Het
Serpinb12 T A 1: 106,949,153 (GRCm38) D66E probably benign Het
Sgsm1 A T 5: 113,255,307 (GRCm38) F958Y probably damaging Het
Slc35e2 T C 4: 155,617,649 (GRCm38) F290S probably benign Het
Sorl1 C T 9: 42,031,914 (GRCm38) V889M possibly damaging Het
Sptlc3 G A 2: 139,636,680 (GRCm38) V520I probably benign Het
Stam A T 2: 14,115,858 (GRCm38) H53L probably damaging Het
Stox2 A G 8: 47,192,935 (GRCm38) S497P probably damaging Het
Tarbp1 A G 8: 126,474,330 (GRCm38) Y246H probably damaging Het
Tbx15 A G 3: 99,352,367 (GRCm38) Y518C probably damaging Het
Tdrd5 T A 1: 156,284,374 (GRCm38) T479S probably benign Het
Tescl T C 7: 24,333,258 (GRCm38) E214G probably damaging Het
Tex10 T C 4: 48,452,946 (GRCm38) D671G probably benign Het
Tmem132d A G 5: 127,984,296 (GRCm38) V414A probably benign Het
Tmem41b T A 7: 109,974,734 (GRCm38) probably benign Het
Tnfrsf18 A G 4: 156,021,880 (GRCm38) probably benign Het
Tulp4 T A 17: 6,198,833 (GRCm38) D42E probably damaging Het
Ubtd1 A G 19: 42,033,664 (GRCm38) N125S probably damaging Het
Ubxn4 T A 1: 128,255,449 (GRCm38) F68I probably benign Het
Urb1 A G 16: 90,776,271 (GRCm38) S958P probably benign Het
Vash2 T C 1: 190,960,301 (GRCm38) S226G probably benign Het
Vmn2r120 C T 17: 57,509,120 (GRCm38) G745E probably damaging Het
Vmn2r58 T A 7: 41,837,693 (GRCm38) I593F probably benign Het
Zfp398 T C 6: 47,840,427 (GRCm38) L67P probably damaging Het
Zfp607b T A 7: 27,703,695 (GRCm38) H525Q probably damaging Het
Zfp629 T C 7: 127,612,320 (GRCm38) T106A probably benign Het
Zfp980 G A 4: 145,702,083 (GRCm38) G461S probably benign Het
Zic5 T A 14: 122,464,800 (GRCm38) D173V probably damaging Het
Zranb2 G A 3: 157,541,884 (GRCm38) probably benign Het
Other mutations in Ankle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Ankle1 APN 8 71,406,259 (GRCm38) missense probably damaging 1.00
IGL02558:Ankle1 APN 8 71,408,992 (GRCm38) missense probably damaging 1.00
IGL02938:Ankle1 APN 8 71,406,252 (GRCm38) missense probably damaging 1.00
R0358:Ankle1 UTSW 8 71,407,545 (GRCm38) missense probably damaging 1.00
R1313:Ankle1 UTSW 8 71,407,213 (GRCm38) missense possibly damaging 0.61
R1313:Ankle1 UTSW 8 71,407,213 (GRCm38) missense possibly damaging 0.61
R1681:Ankle1 UTSW 8 71,407,618 (GRCm38) missense probably benign 0.00
R1776:Ankle1 UTSW 8 71,409,274 (GRCm38) missense probably damaging 0.99
R2070:Ankle1 UTSW 8 71,409,344 (GRCm38) missense probably damaging 1.00
R2073:Ankle1 UTSW 8 71,409,329 (GRCm38) missense possibly damaging 0.94
R2116:Ankle1 UTSW 8 71,407,918 (GRCm38) missense probably benign 0.13
R2117:Ankle1 UTSW 8 71,407,918 (GRCm38) missense probably benign 0.13
R5027:Ankle1 UTSW 8 71,408,979 (GRCm38) missense probably damaging 1.00
R7051:Ankle1 UTSW 8 71,407,743 (GRCm38) missense probably damaging 0.99
R7268:Ankle1 UTSW 8 71,407,545 (GRCm38) missense probably damaging 1.00
R7795:Ankle1 UTSW 8 71,408,693 (GRCm38) missense probably damaging 0.99
R7900:Ankle1 UTSW 8 71,407,417 (GRCm38) missense probably damaging 1.00
R7934:Ankle1 UTSW 8 71,406,255 (GRCm38) missense possibly damaging 0.89
R8046:Ankle1 UTSW 8 71,408,021 (GRCm38) missense probably damaging 1.00
R8118:Ankle1 UTSW 8 71,407,635 (GRCm38) missense probably benign 0.09
R9057:Ankle1 UTSW 8 71,406,317 (GRCm38) missense probably benign 0.00
R9570:Ankle1 UTSW 8 71,406,780 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCAGTTCTGTTTGTACATC -3'
(R):5'- CTGCAGTGACAAACGAAGCATC -3'

Sequencing Primer
(F):5'- CTATCGTGTCAATCACTATCCATGG -3'
(R):5'- CATCGCTGCTGTAGTCTGAG -3'
Posted On 2015-09-25