Incidental Mutation 'R4610:Stox2'
ID344614
Institutional Source Beutler Lab
Gene Symbol Stox2
Ensembl Gene ENSMUSG00000038143
Gene Namestorkhead box 2
Synonyms
MMRRC Submission 041821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R4610 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location47180048-47446362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47192935 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 497 (S497P)
Ref Sequence ENSEMBL: ENSMUSP00000147477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079195] [ENSMUST00000110367] [ENSMUST00000209337] [ENSMUST00000210030] [ENSMUST00000210153] [ENSMUST00000211737] [ENSMUST00000211882]
Predicted Effect probably damaging
Transcript: ENSMUST00000079195
AA Change: S497P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078190
Gene: ENSMUSG00000038143
AA Change: S497P

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Pfam:Stork_head 63 141 4.5e-35 PFAM
low complexity region 225 236 N/A INTRINSIC
low complexity region 352 377 N/A INTRINSIC
low complexity region 459 473 N/A INTRINSIC
low complexity region 654 674 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110367
AA Change: S435P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105996
Gene: ENSMUSG00000038143
AA Change: S435P

DomainStartEndE-ValueType
Pfam:Stork_head 1 79 5.6e-35 PFAM
low complexity region 163 174 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
low complexity region 592 612 N/A INTRINSIC
low complexity region 655 669 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209337
Predicted Effect probably damaging
Transcript: ENSMUST00000210030
AA Change: S435P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000210153
Predicted Effect probably damaging
Transcript: ENSMUST00000211737
AA Change: S497P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211882
AA Change: S561P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.0777 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Storkhead-box_winged-helix domain containing protein. This protein is differentially expressed in decidual tissue and may be involved in the susceptibility to pre-eclampsia with fetal growth restriction. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Adgre1 C A 17: 57,450,073 Q777K possibly damaging Het
Agpat4 G A 17: 12,210,377 probably null Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankle1 AT A 8: 71,407,207 probably benign Het
Ankrd44 T G 1: 54,766,748 probably benign Het
Aprt A T 8: 122,575,415 probably null Het
Aptx T C 4: 40,702,766 probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Bbip1 T C 19: 53,932,175 M1V probably null Het
Cacng7 T A 7: 3,336,691 M36K probably benign Het
Camta1 A G 4: 151,084,827 W156R probably damaging Het
Casd1 G A 6: 4,631,165 probably null Het
Casz1 T A 4: 148,933,267 Y338N probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cit A G 5: 115,994,087 T1801A probably benign Het
Cnot2 A G 10: 116,499,418 I275T probably damaging Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Dst T C 1: 34,169,856 L820P probably damaging Het
Dusp11 T A 6: 85,950,055 N193Y probably damaging Het
Eif3m A T 2: 105,013,288 N116K probably benign Het
Epb41l1 A T 2: 156,509,261 E418D possibly damaging Het
Esyt2 T G 12: 116,318,890 N153K probably damaging Het
Exoc6b T G 6: 85,003,159 probably benign Het
Ezr C T 17: 6,739,722 E502K possibly damaging Het
Fbxw11 T A 11: 32,711,859 Y66N possibly damaging Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Fry T C 5: 150,386,104 L671P probably damaging Het
Galnt7 A G 8: 57,545,769 I262T probably damaging Het
Glp1r T C 17: 30,931,247 F381S probably benign Het
Gm3867 T C 9: 36,257,271 noncoding transcript Het
Gm5662 T C 12: 88,271,774 N72S probably benign Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gstm7 G A 3: 107,926,919 T206I possibly damaging Het
Hist1h2bf A T 13: 23,574,057 V45E possibly damaging Het
Hs3st5 A T 10: 36,828,806 D35V probably benign Het
Hspa13 T C 16: 75,761,302 H125R probably benign Het
Hspa1a T G 17: 34,971,180 H249P probably damaging Het
Igkv10-95 A T 6: 68,680,578 Q6L probably damaging Het
Il1rap T A 16: 26,714,776 L474H probably benign Het
Ipo11 T A 13: 106,879,737 Y489F probably benign Het
Itga5 A G 15: 103,350,832 Y723H probably damaging Het
Itih2 T C 2: 10,105,160 N594S probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Kif26b A G 1: 178,679,355 Y332C probably damaging Het
Kmt2c G A 5: 25,354,384 R1086W probably damaging Het
Ktn1 T A 14: 47,726,179 probably benign Het
Lars2 T A 9: 123,418,693 I305N probably damaging Het
Lgmn G T 12: 102,400,124 probably benign Het
Ltbp4 C T 7: 27,306,700 E1453K probably damaging Het
Lypd8 G A 11: 58,386,849 M152I probably benign Het
Man2a1 T A 17: 64,712,459 S773T probably benign Het
Map2k6 T G 11: 110,499,474 L278R probably damaging Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mms19 A G 19: 41,945,496 V811A possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtcl1 T A 17: 66,377,887 H520L probably benign Het
Mymk A T 2: 27,062,707 F130I probably damaging Het
Myo1f C T 17: 33,582,332 R333C probably damaging Het
Myo9a T A 9: 59,871,882 H1640Q probably benign Het
Nav1 A G 1: 135,592,448 probably benign Het
Ncbp3 G T 11: 73,079,018 G564C probably damaging Het
Ncoa4 A T 14: 32,176,725 I501L probably benign Het
Ngp T A 9: 110,420,815 N60K possibly damaging Het
Npc1l1 G T 11: 6,228,215 D398E probably damaging Het
Nphs2 T A 1: 156,326,131 M264K probably damaging Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr58 T A 9: 19,783,146 Y4* probably null Het
Patz1 A G 11: 3,306,241 Y509C probably damaging Het
Pax8 G A 2: 24,421,583 P447S probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Pex11g C T 8: 3,465,899 V45M probably benign Het
Pik3ip1 T A 11: 3,333,327 S142R probably damaging Het
Pitpnm2 C G 5: 124,125,371 A819P probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plin4 T A 17: 56,105,418 M538L probably benign Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rev1 T C 1: 38,053,649 E1202G probably damaging Het
Rngtt T A 4: 33,339,133 probably benign Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgsm1 A T 5: 113,255,307 F958Y probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorl1 C T 9: 42,031,914 V889M possibly damaging Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stam A T 2: 14,115,858 H53L probably damaging Het
Tarbp1 A G 8: 126,474,330 Y246H probably damaging Het
Tbx15 A G 3: 99,352,367 Y518C probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tescl T C 7: 24,333,258 E214G probably damaging Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tmem132d A G 5: 127,984,296 V414A probably benign Het
Tmem41b T A 7: 109,974,734 probably benign Het
Tnfrsf18 A G 4: 156,021,880 probably benign Het
Tulp4 T A 17: 6,198,833 D42E probably damaging Het
Ubtd1 A G 19: 42,033,664 N125S probably damaging Het
Ubxn4 T A 1: 128,255,449 F68I probably benign Het
Urb1 A G 16: 90,776,271 S958P probably benign Het
Vash2 T C 1: 190,960,301 S226G probably benign Het
Vmn2r120 C T 17: 57,509,120 G745E probably damaging Het
Vmn2r58 T A 7: 41,837,693 I593F probably benign Het
Zfp398 T C 6: 47,840,427 L67P probably damaging Het
Zfp607b T A 7: 27,703,695 H525Q probably damaging Het
Zfp629 T C 7: 127,612,320 T106A probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Zic5 T A 14: 122,464,800 D173V probably damaging Het
Zranb2 G A 3: 157,541,884 probably benign Het
Other mutations in Stox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02234:Stox2 APN 8 47193612 missense probably damaging 1.00
IGL02331:Stox2 APN 8 47191944 missense probably damaging 0.96
IGL02399:Stox2 APN 8 47186538 missense probably damaging 0.99
IGL03091:Stox2 APN 8 47193187 missense possibly damaging 0.66
IGL03143:Stox2 APN 8 47193804 missense possibly damaging 0.78
IGL03307:Stox2 APN 8 47194030 missense probably damaging 1.00
R0082:Stox2 UTSW 8 47203282 splice site probably benign
R0313:Stox2 UTSW 8 47192134 missense probably damaging 1.00
R0382:Stox2 UTSW 8 47203284 splice site probably benign
R0513:Stox2 UTSW 8 47193865 missense probably damaging 1.00
R0539:Stox2 UTSW 8 47194035 missense probably damaging 0.97
R0920:Stox2 UTSW 8 47193018 missense probably damaging 1.00
R1764:Stox2 UTSW 8 47194016 nonsense probably null
R1923:Stox2 UTSW 8 47193626 missense probably damaging 1.00
R2311:Stox2 UTSW 8 47191978 missense probably damaging 1.00
R3196:Stox2 UTSW 8 47192830 missense probably damaging 0.99
R3715:Stox2 UTSW 8 47413152 missense possibly damaging 0.90
R4300:Stox2 UTSW 8 47193992 nonsense probably null
R4534:Stox2 UTSW 8 47193379 missense probably damaging 1.00
R4600:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4601:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4602:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4603:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4624:Stox2 UTSW 8 47193816 missense probably damaging 1.00
R4672:Stox2 UTSW 8 47192106 missense probably damaging 1.00
R4888:Stox2 UTSW 8 47203163 missense probably damaging 1.00
R4944:Stox2 UTSW 8 47413265 missense possibly damaging 0.46
R5331:Stox2 UTSW 8 47413627 utr 5 prime probably benign
R5349:Stox2 UTSW 8 47287916 missense possibly damaging 0.70
R5367:Stox2 UTSW 8 47203225 missense probably damaging 1.00
R5471:Stox2 UTSW 8 47193513 missense probably damaging 0.96
R5561:Stox2 UTSW 8 47193006 missense probably damaging 1.00
R5630:Stox2 UTSW 8 47191890 missense probably damaging 1.00
R5719:Stox2 UTSW 8 47413137 nonsense probably null
R5733:Stox2 UTSW 8 47413137 nonsense probably null
R5996:Stox2 UTSW 8 47203147 missense possibly damaging 0.93
R6170:Stox2 UTSW 8 47192020 missense probably benign 0.02
R6458:Stox2 UTSW 8 47192044 missense possibly damaging 0.66
R6786:Stox2 UTSW 8 47186465 missense probably damaging 1.00
R6815:Stox2 UTSW 8 47193101 missense probably damaging 1.00
R6951:Stox2 UTSW 8 47203132 missense probably damaging 1.00
R7193:Stox2 UTSW 8 47186454 missense probably benign
R7330:Stox2 UTSW 8 47192236 missense possibly damaging 0.61
R7552:Stox2 UTSW 8 47203119 critical splice donor site probably null
R8001:Stox2 UTSW 8 47186477 missense probably benign 0.06
X0027:Stox2 UTSW 8 47193840 missense possibly damaging 0.95
Z1177:Stox2 UTSW 8 47194050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCATACCTCTTTGTAGCTGG -3'
(R):5'- TGCATAGCAACACGAACGTG -3'

Sequencing Primer
(F):5'- CATACCTCTTTGTAGCTGGCAGAAG -3'
(R):5'- GAACGTGATCGAGTCCCATTTC -3'
Posted On2015-09-25