Incidental Mutation 'R4610:Epb41l1'
ID 344579
Institutional Source Beutler Lab
Gene Symbol Epb41l1
Ensembl Gene ENSMUSG00000027624
Gene Name erythrocyte membrane protein band 4.1 like 1
Synonyms 4.1N, Epb4.1l1
MMRRC Submission 041821-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4610 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 156262829-156385134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 156351181 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 418 (E418D)
Ref Sequence ENSEMBL: ENSMUSP00000105202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029155] [ENSMUST00000103135] [ENSMUST00000103136] [ENSMUST00000103137] [ENSMUST00000109572] [ENSMUST00000109574] [ENSMUST00000125153] [ENSMUST00000109577]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029155
AA Change: E418D

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029155
Gene: ENSMUSG00000027624
AA Change: E418D

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103135
AA Change: E418D

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099424
Gene: ENSMUSG00000027624
AA Change: E418D

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103136
AA Change: E418D

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099425
Gene: ENSMUSG00000027624
AA Change: E418D

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103137
AA Change: E418D

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099426
Gene: ENSMUSG00000027624
AA Change: E418D

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109572
AA Change: E345D

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105200
Gene: ENSMUSG00000027624
AA Change: E345D

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 215 5.6e-12 SMART
FERM_C 219 309 1.2e-43 SMART
FA 311 357 9e-22 SMART
low complexity region 386 399 N/A INTRINSIC
Pfam:SAB 408 459 2.2e-21 PFAM
Pfam:4_1_CTD 514 619 1.3e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109574
AA Change: E418D

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105202
Gene: ENSMUSG00000027624
AA Change: E418D

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 480 531 4.8e-24 PFAM
Pfam:4_1_CTD 610 718 4.9e-46 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144013
AA Change: E112D
Predicted Effect probably benign
Transcript: ENSMUST00000125153
AA Change: E418D

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121161
Gene: ENSMUSG00000027624
AA Change: E418D

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 492 543 7.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109577
AA Change: E418D

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105205
Gene: ENSMUSG00000027624
AA Change: E418D

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 481 532 5.9e-24 PFAM
low complexity region 594 603 N/A INTRINSIC
Pfam:4_1_CTD 758 855 5.8e-46 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (121/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Erythrocyte membrane protein band 4.1 (EPB41) is a multifunctional protein that mediates interactions between the erythrocyte cytoskeleton and the overlying plasma membrane. The encoded protein binds and stabilizes D2 and D3 dopamine receptors at the neuronal plasma membrane. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,827,847 (GRCm39) D555E probably damaging Het
Adgre1 C A 17: 57,757,073 (GRCm39) Q777K possibly damaging Het
Agpat4 G A 17: 12,429,264 (GRCm39) probably null Het
Ak7 G A 12: 105,679,834 (GRCm39) V123M probably benign Het
Ankle1 AT A 8: 71,859,851 (GRCm39) probably benign Het
Ankrd44 T G 1: 54,805,907 (GRCm39) probably benign Het
Aprt A T 8: 123,302,154 (GRCm39) probably null Het
Aptx T C 4: 40,702,766 (GRCm39) probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
AY358078 T A 14: 52,063,532 (GRCm39) C393S possibly damaging Het
Bbip1 T C 19: 53,920,606 (GRCm39) M1V probably null Het
Cacng7 T A 7: 3,385,207 (GRCm39) M36K probably benign Het
Camta1 A G 4: 151,169,284 (GRCm39) W156R probably damaging Het
Casd1 G A 6: 4,631,165 (GRCm39) probably null Het
Casz1 T A 4: 149,017,724 (GRCm39) Y338N probably damaging Het
Ccdc66 T C 14: 27,222,377 (GRCm39) N122S probably damaging Het
Celf2 G T 2: 6,590,831 (GRCm39) N279K possibly damaging Het
Cfap96 A T 8: 46,423,505 (GRCm39) I69N probably damaging Het
Cit A G 5: 116,132,146 (GRCm39) T1801A probably benign Het
Cnot2 A G 10: 116,335,323 (GRCm39) I275T probably damaging Het
Ddx4 T C 13: 112,748,594 (GRCm39) K435E probably damaging Het
Dnajc6 T C 4: 101,468,461 (GRCm39) F166L probably damaging Het
Dst T C 1: 34,208,937 (GRCm39) L820P probably damaging Het
Dusp11 T A 6: 85,927,037 (GRCm39) N193Y probably damaging Het
Eif1ad7 T C 12: 88,238,544 (GRCm39) N72S probably benign Het
Eif3m A T 2: 104,843,633 (GRCm39) N116K probably benign Het
Esyt2 T G 12: 116,282,510 (GRCm39) N153K probably damaging Het
Exoc6b T G 6: 84,980,141 (GRCm39) probably benign Het
Ezr C T 17: 7,007,121 (GRCm39) E502K possibly damaging Het
Fbxw11 T A 11: 32,661,859 (GRCm39) Y66N possibly damaging Het
Frem2 A G 3: 53,455,228 (GRCm39) L2116S possibly damaging Het
Fry T C 5: 150,309,569 (GRCm39) L671P probably damaging Het
Galnt7 A G 8: 57,998,803 (GRCm39) I262T probably damaging Het
Glp1r T C 17: 31,150,221 (GRCm39) F381S probably benign Het
Gm3867 T C 9: 36,168,567 (GRCm39) noncoding transcript Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Golgb1 A G 16: 36,738,987 (GRCm39) D2442G probably damaging Het
Gp1bb A T 16: 18,439,893 (GRCm39) L67Q probably damaging Het
Gstm7 G A 3: 107,834,235 (GRCm39) T206I possibly damaging Het
H2bc7 A T 13: 23,758,231 (GRCm39) V45E possibly damaging Het
Hs3st5 A T 10: 36,704,802 (GRCm39) D35V probably benign Het
Hspa13 T C 16: 75,558,190 (GRCm39) H125R probably benign Het
Hspa1a T G 17: 35,190,156 (GRCm39) H249P probably damaging Het
Igkv10-95 A T 6: 68,657,562 (GRCm39) Q6L probably damaging Het
Il1rap T A 16: 26,533,526 (GRCm39) L474H probably benign Het
Ipo11 T A 13: 107,016,245 (GRCm39) Y489F probably benign Het
Itga5 A G 15: 103,259,259 (GRCm39) Y723H probably damaging Het
Itih2 T C 2: 10,109,971 (GRCm39) N594S probably damaging Het
Itk T A 11: 46,227,342 (GRCm39) Q427L probably benign Het
Kif26b A G 1: 178,506,920 (GRCm39) Y332C probably damaging Het
Kmt2c G A 5: 25,559,382 (GRCm39) R1086W probably damaging Het
Ktn1 T A 14: 47,963,636 (GRCm39) probably benign Het
Lars2 T A 9: 123,247,758 (GRCm39) I305N probably damaging Het
Lgmn G T 12: 102,366,383 (GRCm39) probably benign Het
Ltbp4 C T 7: 27,006,125 (GRCm39) E1453K probably damaging Het
Lypd8 G A 11: 58,277,675 (GRCm39) M152I probably benign Het
Man2a1 T A 17: 65,019,454 (GRCm39) S773T probably benign Het
Map2k6 T G 11: 110,390,300 (GRCm39) L278R probably damaging Het
Mbtps1 A T 8: 120,262,086 (GRCm39) D354E probably damaging Het
Mcpt9 C T 14: 56,266,049 (GRCm39) V60M probably damaging Het
Mical3 C A 6: 120,911,799 (GRCm39) E1083* probably null Het
Mms19 A G 19: 41,933,935 (GRCm39) V811A possibly damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mtcl1 T A 17: 66,684,882 (GRCm39) H520L probably benign Het
Mymk A T 2: 26,952,719 (GRCm39) F130I probably damaging Het
Myo1f C T 17: 33,801,306 (GRCm39) R333C probably damaging Het
Myo9a T A 9: 59,779,165 (GRCm39) H1640Q probably benign Het
Nav1 A G 1: 135,520,186 (GRCm39) probably benign Het
Ncbp3 G T 11: 72,969,844 (GRCm39) G564C probably damaging Het
Ncoa4 A T 14: 31,898,682 (GRCm39) I501L probably benign Het
Ngp T A 9: 110,249,883 (GRCm39) N60K possibly damaging Het
Npc1l1 G T 11: 6,178,215 (GRCm39) D398E probably damaging Het
Nphs2 T A 1: 156,153,701 (GRCm39) M264K probably damaging Het
Or4s2b G A 2: 88,508,240 (GRCm39) V14I probably benign Het
Or4s2b T G 2: 88,508,523 (GRCm39) V101G probably benign Het
Or7e165 T A 9: 19,694,442 (GRCm39) Y4* probably null Het
Or8b8 T A 9: 37,809,622 (GRCm39) S307R probably benign Het
Patz1 A G 11: 3,256,241 (GRCm39) Y509C probably damaging Het
Pax8 G A 2: 24,311,595 (GRCm39) P447S probably damaging Het
Pde11a A G 2: 75,988,677 (GRCm39) V488A probably benign Het
Pex11g C T 8: 3,515,899 (GRCm39) V45M probably benign Het
Pik3ip1 T A 11: 3,283,327 (GRCm39) S142R probably damaging Het
Pitpnm2 C G 5: 124,263,434 (GRCm39) A819P probably damaging Het
Pla2g4e T G 2: 120,016,863 (GRCm39) H226P possibly damaging Het
Plin4 T A 17: 56,412,418 (GRCm39) M538L probably benign Het
Ppp3cb T C 14: 20,570,714 (GRCm39) N339S possibly damaging Het
Rev1 T C 1: 38,092,730 (GRCm39) E1202G probably damaging Het
Rngtt T A 4: 33,339,133 (GRCm39) probably benign Het
Serpinb12 T A 1: 106,876,883 (GRCm39) D66E probably benign Het
Sgsm1 A T 5: 113,403,173 (GRCm39) F958Y probably damaging Het
Slc35e2 T C 4: 155,702,106 (GRCm39) F290S probably benign Het
Sorl1 C T 9: 41,943,210 (GRCm39) V889M possibly damaging Het
Sptlc3 G A 2: 139,478,600 (GRCm39) V520I probably benign Het
Stam A T 2: 14,120,669 (GRCm39) H53L probably damaging Het
Stox2 A G 8: 47,645,970 (GRCm39) S497P probably damaging Het
Tarbp1 A G 8: 127,201,069 (GRCm39) Y246H probably damaging Het
Tbx15 A G 3: 99,259,683 (GRCm39) Y518C probably damaging Het
Tdrd5 T A 1: 156,111,944 (GRCm39) T479S probably benign Het
Tescl T C 7: 24,032,683 (GRCm39) E214G probably damaging Het
Tex10 T C 4: 48,452,946 (GRCm39) D671G probably benign Het
Tmem132d A G 5: 128,061,360 (GRCm39) V414A probably benign Het
Tmem41b T A 7: 109,573,941 (GRCm39) probably benign Het
Tnfrsf18 A G 4: 156,106,337 (GRCm39) probably benign Het
Tulp4 T A 17: 6,249,108 (GRCm39) D42E probably damaging Het
Ubtd1 A G 19: 42,022,103 (GRCm39) N125S probably damaging Het
Ubxn4 T A 1: 128,183,186 (GRCm39) F68I probably benign Het
Urb1 A G 16: 90,573,159 (GRCm39) S958P probably benign Het
Vash2 T C 1: 190,692,498 (GRCm39) S226G probably benign Het
Vmn2r120 C T 17: 57,816,120 (GRCm39) G745E probably damaging Het
Vmn2r58 T A 7: 41,487,117 (GRCm39) I593F probably benign Het
Zfp398 T C 6: 47,817,361 (GRCm39) L67P probably damaging Het
Zfp607b T A 7: 27,403,120 (GRCm39) H525Q probably damaging Het
Zfp629 T C 7: 127,211,492 (GRCm39) T106A probably benign Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Zic5 T A 14: 122,702,212 (GRCm39) D173V probably damaging Het
Zranb2 G A 3: 157,247,521 (GRCm39) probably benign Het
Other mutations in Epb41l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Epb41l1 APN 2 156,366,939 (GRCm39) missense probably damaging 1.00
IGL00852:Epb41l1 APN 2 156,345,638 (GRCm39) missense probably damaging 1.00
IGL02148:Epb41l1 APN 2 156,353,748 (GRCm39) intron probably benign
IGL02164:Epb41l1 APN 2 156,336,869 (GRCm39) splice site probably benign
IGL02515:Epb41l1 APN 2 156,378,933 (GRCm39) missense probably damaging 1.00
R0787:Epb41l1 UTSW 2 156,336,010 (GRCm39) missense probably damaging 0.98
R1450:Epb41l1 UTSW 2 156,353,745 (GRCm39) intron probably benign
R1566:Epb41l1 UTSW 2 156,363,879 (GRCm39) missense probably benign 0.06
R1759:Epb41l1 UTSW 2 156,363,894 (GRCm39) missense probably benign 0.06
R1812:Epb41l1 UTSW 2 156,338,431 (GRCm39) missense probably damaging 1.00
R1908:Epb41l1 UTSW 2 156,352,737 (GRCm39) missense possibly damaging 0.80
R2152:Epb41l1 UTSW 2 156,356,048 (GRCm39) missense probably damaging 1.00
R3023:Epb41l1 UTSW 2 156,356,129 (GRCm39) missense probably damaging 0.99
R4178:Epb41l1 UTSW 2 156,363,477 (GRCm39) missense probably benign
R4491:Epb41l1 UTSW 2 156,364,088 (GRCm39) missense probably benign 0.00
R4770:Epb41l1 UTSW 2 156,371,344 (GRCm39) missense probably benign 0.00
R5038:Epb41l1 UTSW 2 156,363,330 (GRCm39) missense probably benign 0.12
R5049:Epb41l1 UTSW 2 156,366,859 (GRCm39) missense possibly damaging 0.95
R5129:Epb41l1 UTSW 2 156,351,201 (GRCm39) missense possibly damaging 0.80
R5624:Epb41l1 UTSW 2 156,375,691 (GRCm39) splice site probably benign
R5780:Epb41l1 UTSW 2 156,338,445 (GRCm39) missense probably damaging 1.00
R5810:Epb41l1 UTSW 2 156,341,575 (GRCm39) missense probably damaging 1.00
R5952:Epb41l1 UTSW 2 156,366,903 (GRCm39) missense probably benign
R5952:Epb41l1 UTSW 2 156,345,708 (GRCm39) missense probably damaging 1.00
R5961:Epb41l1 UTSW 2 156,363,706 (GRCm39) missense probably benign 0.25
R6118:Epb41l1 UTSW 2 156,364,397 (GRCm39) missense probably benign 0.13
R6496:Epb41l1 UTSW 2 156,375,716 (GRCm39) missense possibly damaging 0.92
R6861:Epb41l1 UTSW 2 156,367,142 (GRCm39) missense probably benign
R6959:Epb41l1 UTSW 2 156,341,507 (GRCm39) missense probably benign 0.03
R7009:Epb41l1 UTSW 2 156,376,603 (GRCm39) splice site probably null
R7036:Epb41l1 UTSW 2 156,371,322 (GRCm39) missense probably benign
R7046:Epb41l1 UTSW 2 156,368,812 (GRCm39) missense possibly damaging 0.56
R7263:Epb41l1 UTSW 2 156,337,043 (GRCm39) critical splice donor site probably null
R7322:Epb41l1 UTSW 2 156,345,771 (GRCm39) missense probably damaging 0.98
R7398:Epb41l1 UTSW 2 156,376,682 (GRCm39) missense probably damaging 1.00
R7914:Epb41l1 UTSW 2 156,364,128 (GRCm39) missense probably benign 0.03
R8039:Epb41l1 UTSW 2 156,348,332 (GRCm39) missense probably damaging 0.99
R8357:Epb41l1 UTSW 2 156,367,171 (GRCm39) missense probably benign 0.16
R8415:Epb41l1 UTSW 2 156,368,873 (GRCm39) missense probably benign 0.00
R8457:Epb41l1 UTSW 2 156,367,171 (GRCm39) missense probably benign 0.16
R8458:Epb41l1 UTSW 2 156,363,684 (GRCm39) missense probably benign 0.00
R8475:Epb41l1 UTSW 2 156,364,150 (GRCm39) missense probably damaging 0.98
R8790:Epb41l1 UTSW 2 156,345,722 (GRCm39) missense possibly damaging 0.62
R8851:Epb41l1 UTSW 2 156,364,431 (GRCm39) missense probably benign 0.03
R8898:Epb41l1 UTSW 2 156,335,869 (GRCm39) missense probably damaging 0.97
R8955:Epb41l1 UTSW 2 156,363,923 (GRCm39) missense probably benign 0.01
R8988:Epb41l1 UTSW 2 156,363,591 (GRCm39) missense probably benign 0.25
R9060:Epb41l1 UTSW 2 156,345,679 (GRCm39) nonsense probably null
R9121:Epb41l1 UTSW 2 156,364,487 (GRCm39) missense probably benign
R9602:Epb41l1 UTSW 2 156,367,068 (GRCm39) missense probably damaging 0.99
R9644:Epb41l1 UTSW 2 156,367,165 (GRCm39) missense possibly damaging 0.51
R9690:Epb41l1 UTSW 2 156,356,038 (GRCm39) missense probably damaging 0.99
X0065:Epb41l1 UTSW 2 156,351,197 (GRCm39) missense probably damaging 1.00
Z1177:Epb41l1 UTSW 2 156,350,747 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GACCTTGGGCCTGGAAATAC -3'
(R):5'- GTGCAAATGACCTTGAAGCATC -3'

Sequencing Primer
(F):5'- GGAAATACAAGTTTGGTTCCTACCCC -3'
(R):5'- ACAATACTACTACCGGCTGTCTC -3'
Posted On 2015-09-25