Mutagenetix > Incidental Mutations

Incidental Mutation 'R4627:Tbk1'

348886

Institutional Source

Beutler Lab

Gene Symbol

Tbk1

Ensembl Gene

ENSMUSG00000020115

Gene Name

TANK-binding kinase 1

Synonyms

1200008B05Rik

MMRRC Submission

041892-MU

Accession Numbers

MGI: 1929658

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4627 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121546455-121586787 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121568080 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 254 (N254S)

Ref Sequence

ENSEMBL: ENSMUSP00000020316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020316] [ENSMUST00000219400] [ENSMUST00000219493]

PDB Structure

Crystal structure of mouse TBK1 bound to BX795 [X-RAY DIFFRACTION]
Crystal structure of mouse TBK1 bound to SU6668 [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020316
AA Change: N254S

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020316
Gene: ENSMUSG00000020115
AA Change: N254S

Domain	Start	End	E-Value	Type
Pfam:Pkinase	9	300	2.6e-46	PFAM
Pfam:Pkinase_Tyr	10	250	1.5e-27	PFAM
low complexity region	355	366	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219244

Predicted Effect

probably benign
Transcript: ENSMUST00000219400

Predicted Effect

probably benign
Transcript: ENSMUST00000219493

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality. Mice homozygous for a different knock-out allele exhibit increased prenatal lethality, increased infiltration of mononuclear and/or granulomatous cells in multiple organs and tissues at 3 months of age, and increased lethality in response to LPS. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Targeted(5) Gene trapped(18)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	C	13: 63,068,092	S393P	probably benign	Het
Adam6a	A	T	12: 113,544,949	D314V	probably benign	Het
Adamts18	C	T	8: 113,773,168	W371*	probably null	Het
Adamtsl2	T	A	2: 27,093,585	L331Q	probably damaging	Het
Akr1c13	G	T	13: 4,197,870	V214F	probably damaging	Het
Aldoart1	T	C	4: 72,852,443	T43A	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ano7	T	C	1: 93,375,185	I15T	probably benign	Het
Aox3	A	T	1: 58,125,035	T155S	probably damaging	Het
Ap2a1	C	T	7: 44,904,419	V535M	probably damaging	Het
Apbb2	C	T	5: 66,400,076		probably null	Het
Astn1	C	A	1: 158,502,251	H225Q	possibly damaging	Het
Atm	A	G	9: 53,456,506	I2439T	possibly damaging	Het
Atp1b2	T	A	11: 69,601,334	I263F	probably damaging	Het
Ccdc184	A	T	15: 98,168,757	N148Y	probably benign	Het
Cdca7	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA	2: 72,481,861		probably benign	Het
Cep192	C	G	18: 67,812,369	P180R	probably benign	Het
Cfap46	T	C	7: 139,657,281	Y571C	probably damaging	Het
Cfap46	A	T	7: 139,680,927	L85Q	probably damaging	Het
Chchd6	G	A	6: 89,384,660	L226F	probably damaging	Het
Cnot6l	A	G	5: 96,077,211	V541A	probably benign	Het
Cobl	T	C	11: 12,251,093	E1214G	probably damaging	Het
Cpsf2	G	A	12: 101,989,895	R319Q	probably benign	Het
Csdc2	T	C	15: 81,949,123	V107A	probably benign	Het
Csmd1	A	G	8: 16,697,917	W273R	probably benign	Het
Diexf	T	C	1: 193,107,695	T719A	probably benign	Het
Dnah2	T	A	11: 69,465,376	N2156I	probably damaging	Het
Dsp	A	G	13: 38,168,641	Y165C	probably benign	Het
Exoc1	T	C	5: 76,542,228	V205A	probably benign	Het
Fam98c	T	C	7: 29,155,268	T49A	possibly damaging	Het
Fbln2	G	T	6: 91,259,767	V755L	probably damaging	Het
Fhad1	A	T	4: 141,896,468	V1371D	possibly damaging	Het
Folh1	A	T	7: 86,773,252	M59K	probably benign	Het
Foxf2	A	T	13: 31,626,888	H270L	probably benign	Het
Gm14401	G	A	2: 177,086,316	R65H	probably benign	Het
Gpn1	C	A	5: 31,498,393	Y592*	probably null	Het
Hmcn1	T	G	1: 150,595,894	D4903A	probably benign	Het
Hnf1a	T	C	5: 114,955,871	R220G	probably damaging	Het
Hoxd10	G	A	2: 74,692,292	A105T	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kidins220	C	T	12: 25,057,042	T1498I	possibly damaging	Het
Klhl2	G	T	8: 64,758,191	Y274*	probably null	Het
Lmbrd1	A	G	1: 24,705,999	Y140C	probably damaging	Het
Mapk8ip3	G	A	17: 24,903,293	T706I	probably benign	Het
Mast4	A	C	13: 103,334,021	S58A	possibly damaging	Het
Mcm6	T	C	1: 128,351,548	D167G	probably benign	Het
Mmachc	A	T	4: 116,703,471	S276T	probably damaging	Het
Nfat5	A	T	8: 107,369,276	Q1289L	probably damaging	Het
Nlrc4	G	T	17: 74,446,628	F253L	probably damaging	Het
Nr1i3	C	A	1: 171,216,445	A112E	probably benign	Het
Olfr1367	T	C	13: 21,347,464	F179L	probably damaging	Het
Olfr45	T	A	7: 140,691,378	S158T	probably benign	Het
Olfr455	T	A	6: 42,538,441	T194S	possibly damaging	Het
Olfr853	G	T	9: 19,537,673	Q86K	possibly damaging	Het
Orc5	G	T	5: 22,548,005	F10L	probably benign	Het
Pde10a	A	C	17: 8,981,652	D779A	probably damaging	Het
Pde4b	T	C	4: 102,601,605	L486S	probably damaging	Het
Pex2	A	T	3: 5,561,281	I156N	probably damaging	Het
Phtf2	C	T	5: 20,773,740	R63Q	probably damaging	Het
Prag1	A	G	8: 36,103,292	Y343C	probably damaging	Het
Prdm16	A	T	4: 154,367,240	Y170N	probably damaging	Het
Prpf6	A	C	2: 181,601,474	K5T	probably damaging	Het
Ptpn1	A	G	2: 167,967,781	K103R	probably benign	Het
Ralgapa2	A	G	2: 146,361,453	S1159P	possibly damaging	Het
Rapgef3	G	T	15: 97,758,929	D318E	probably damaging	Het
Ripk4	A	T	16: 97,744,026	S474T	probably damaging	Het
Rmi1	A	G	13: 58,409,136	R400G	probably benign	Het
Sec16a	A	G	2: 26,429,393	V1491A	probably damaging	Het
Sec16a	C	T	2: 26,431,068		probably null	Het
Setd7	G	T	3: 51,542,665	N113K	probably damaging	Het
Shank2	C	T	7: 144,411,424	T1502M	probably damaging	Het
Skor1	A	T	9: 63,145,476	C376S	probably damaging	Het
Slc12a3	A	T	8: 94,329,384	L49F	probably benign	Het
Slc35d3	C	T	10: 19,849,331	V260M	probably damaging	Het
Slc46a1	T	A	11: 78,466,889	V256E	probably benign	Het
Slc6a1	T	C	6: 114,308,106	S127P	probably benign	Het
Syngr4	A	G	7: 45,887,028	L190P	probably damaging	Het
Tagap	G	A	17: 7,926,941		probably null	Het
Tamm41	A	T	6: 115,035,002	N89K	probably benign	Het
Tbc1d31	T	A	15: 57,967,912	M922K	probably benign	Het
Tfec	A	G	6: 16,840,479	S140P	probably damaging	Het
Tnrc18	T	C	5: 142,740,128	E1802G	unknown	Het
Tom1l2	C	T	11: 60,242,707		probably null	Het
Tonsl	T	G	15: 76,637,224	K323Q	probably damaging	Het
Tsnaxip1	A	T	8: 105,841,407	E268D	probably damaging	Het
Ttf1	C	A	2: 29,065,160	H179N	possibly damaging	Het
Ttn	T	C	2: 76,726,173	S30163G	probably damaging	Het
Ube2c	A	G	2: 164,772,173	N143S	possibly damaging	Het
Ugt1a10	G	A	1: 88,218,390	R519Q	probably damaging	Het
Vmn2r9	T	C	5: 108,847,597	Y395C	probably damaging	Het
Vwa8	G	A	14: 79,103,697		probably null	Het
Zfp9	A	G	6: 118,464,976	Y242H	probably damaging	Het

Other mutations in Tbk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Tbk1	APN	10	121552250	missense	probably benign	0.00
IGL01021:Tbk1	APN	10	121551272	missense	probably benign	0.07
IGL01371:Tbk1	APN	10	121559871	missense	probably benign	0.09
IGL01383:Tbk1	APN	10	121576279	missense	probably damaging	1.00
IGL01583:Tbk1	APN	10	121557229	missense	probably benign
IGL01734:Tbk1	APN	10	121571983	nonsense	probably null
IGL02068:Tbk1	APN	10	121570789	missense	probably damaging	1.00
IGL02676:Tbk1	APN	10	121568080	missense	possibly damaging	0.82
IGL02737:Tbk1	APN	10	121559862	missense	probably null	0.96
IGL03334:Tbk1	APN	10	121584199	missense	possibly damaging	0.79
pioneer	UTSW	10	121578690	missense	probably damaging	1.00
trailblazer	UTSW	10	121570685	missense	probably damaging	1.00
R0030:Tbk1	UTSW	10	121561624	missense	probably benign	0.09
R0386:Tbk1	UTSW	10	121584254	missense	probably damaging	0.96
R1396:Tbk1	UTSW	10	121571916	missense	probably damaging	1.00
R1430:Tbk1	UTSW	10	121559934	missense	probably benign
R1522:Tbk1	UTSW	10	121551318	missense	probably benign	0.06
R1542:Tbk1	UTSW	10	121559935	missense	probably benign
R1717:Tbk1	UTSW	10	121561645	missense	probably benign	0.10
R1860:Tbk1	UTSW	10	121547171	missense	probably benign	0.01
R2188:Tbk1	UTSW	10	121563931	nonsense	probably null
R2519:Tbk1	UTSW	10	121557259	missense	probably benign	0.03
R4945:Tbk1	UTSW	10	121551269	missense	probably damaging	0.98
R5061:Tbk1	UTSW	10	121576336	missense	possibly damaging	0.62
R5256:Tbk1	UTSW	10	121570685	missense	probably damaging	1.00
R5310:Tbk1	UTSW	10	121556051	missense	probably benign	0.00
R6187:Tbk1	UTSW	10	121584243	missense	probably benign	0.02
R6425:Tbk1	UTSW	10	121563962	missense	probably benign	0.00
R6512:Tbk1	UTSW	10	121578621	missense	probably damaging	1.00
R6897:Tbk1	UTSW	10	121559877	missense	probably benign	0.00
R7268:Tbk1	UTSW	10	121552499	missense	probably benign	0.03
R7609:Tbk1	UTSW	10	121552501	missense	probably damaging	0.98
R7860:Tbk1	UTSW	10	121552246	missense	possibly damaging	0.55
R7943:Tbk1	UTSW	10	121552246	missense	possibly damaging	0.55
X0022:Tbk1	UTSW	10	121560293	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGACCTGCTTGAGTTCCAGTC -3'
(R):5'- GGTCACAGAGGGCTTTAGTC -3'

Sequencing Primer
(F):5'- ACTTCCTTGGTGATGATCAGC -3'
(R):5'- CACAGAGGGCTTTAGTCGATGATTG -3'

Posted On

2015-10-08