Incidental Mutation 'R4613:Areg'
ID 350950
Institutional Source Beutler Lab
Gene Symbol Areg
Ensembl Gene ENSMUSG00000029378
Gene Name amphiregulin
Synonyms AR, Sdgf
MMRRC Submission 041824-MU
Accession Numbers

MGI: 88068; Ncbi RefSeq: NM_009704
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4613 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 91139599-91148432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 91143504 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 102 (K102R)
Ref Sequence ENSEMBL: ENSMUSP00000031325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031325]
AlphaFold P31955
Predicted Effect probably benign
Transcript: ENSMUST00000031325
AA Change: K102R

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031325
Gene: ENSMUSG00000029378
AA Change: K102R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF 138 175 7.41e0 SMART
transmembrane domain 193 215 N/A INTRINSIC
low complexity region 222 240 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the epidermal growth factor (EGF) family and preproprotein that is proteolytically processed to generate a mature protein product. The encoded protein is a ligand of the epidermal growth factor receptor (EGFR) and has been shown to play a role in immunity, inflammation, tissue repair, and lung and mammary gland development. Homozygous knockout mice for this gene exhibit impaired immune system regulation in the skin and gene expression changes characteristic of chronic liver damage. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired development of mammary gland ducts in pubescent females. Mutant ducts show retarded elongation with few terminal end buds. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,557 L130I probably benign Het
Abca9 A G 11: 110,144,784 V670A probably benign Het
Adad1 A G 3: 37,092,033 N517D probably damaging Het
Ankle2 T C 5: 110,231,379 L48P probably benign Het
Aoc3 A T 11: 101,337,659 probably benign Het
Bmp1 T C 14: 70,508,523 T167A probably damaging Het
C4b C T 17: 34,734,551 G986D probably benign Het
Caml G T 13: 55,625,142 G200C probably damaging Het
Ccdc40 A C 11: 119,231,532 R53S probably benign Het
Cdh22 T A 2: 165,143,656 I337L probably benign Het
Col12a1 A T 9: 79,647,601 V2065D probably benign Het
Copg2 A G 6: 30,811,596 S591P probably benign Het
Cyp2d34 G A 15: 82,616,325 P438S probably damaging Het
Dchs1 T C 7: 105,772,724 D163G probably damaging Het
Depdc1b T C 13: 108,363,643 V230A probably damaging Het
Depdc5 T A 5: 32,975,446 L1300H probably damaging Het
Dnah10 G T 5: 124,762,869 probably null Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dthd1 A G 5: 62,827,068 D372G probably damaging Het
Eogt G T 6: 97,134,304 Q199K probably benign Het
Epha6 C A 16: 59,666,597 R1029L possibly damaging Het
Eppin C A 2: 164,589,323 E128* probably null Het
Fam102b A T 3: 109,027,255 F23I probably benign Het
Fam160b1 C A 19: 57,371,187 P53Q probably damaging Het
Fgf20 T C 8: 40,286,611 R33G probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Gba C T 3: 89,208,644 probably null Het
Gli2 A G 1: 118,837,511 V970A probably damaging Het
Gramd1b A T 9: 40,307,993 V508D probably damaging Het
Gucy2c T A 6: 136,708,321 D898V probably damaging Het
Kcnj15 T C 16: 95,295,794 Y92H probably damaging Het
L3mbtl3 A T 10: 26,282,795 S652T unknown Het
Ldb2 G T 5: 44,476,551 Q326K probably benign Het
Lipi C A 16: 75,560,801 R292L probably benign Het
Lrrc36 G A 8: 105,449,614 V207I possibly damaging Het
Lyplal1 C T 1: 186,088,752 G166D probably benign Het
Map1b A T 13: 99,430,302 Y1970* probably null Het
Map2 A G 1: 66,425,469 N287D probably damaging Het
Map3k11 A T 19: 5,697,470 Q578L probably benign Het
Map3k11 G T 19: 5,697,471 Q578H probably damaging Het
Map4k4 G A 1: 40,017,191 S1012N probably benign Het
Mapk13 A T 17: 28,769,452 N15Y probably damaging Het
Mapk15 G A 15: 75,995,910 A125T probably damaging Het
Mrgprb1 C A 7: 48,447,708 R152L possibly damaging Het
Muc5ac T G 7: 141,791,103 Y104D possibly damaging Het
Myo1h A G 5: 114,348,379 N566S possibly damaging Het
Myo1h C A 5: 114,351,676 H647Q probably benign Het
Neo1 A G 9: 58,889,041 I1201T possibly damaging Het
Nlgn1 T C 3: 25,436,022 T514A probably benign Het
Olfr120 A G 17: 37,726,696 Y224C probably damaging Het
Olfr533 A T 7: 140,467,068 Y289F probably damaging Het
Olfr8 A G 10: 78,956,065 N287D probably damaging Het
Olfr985 T A 9: 40,127,722 K80* probably null Het
Orc2 A T 1: 58,500,309 L57* probably null Het
Otoa G A 7: 121,145,568 V850M probably damaging Het
Pcnx3 T C 19: 5,667,219 T1579A possibly damaging Het
Pde5a A T 3: 122,823,093 Y564F probably damaging Het
Pdxk A C 10: 78,447,919 I147S probably damaging Het
Pfdn5 A G 15: 102,328,752 D108G probably benign Het
Pink1 T C 4: 138,317,310 D342G probably damaging Het
Prkacb A T 3: 146,737,998 V336E probably damaging Het
Ptpro C A 6: 137,416,836 S13* probably null Het
Rfng A G 11: 120,782,650 L215P probably damaging Het
Rpn2 T C 2: 157,302,425 F336L possibly damaging Het
Sacs A G 14: 61,211,797 probably null Het
Sirpb1a T A 3: 15,417,037 Y77F probably benign Het
Skiv2l2 C A 13: 112,921,739 E53* probably null Het
Slc30a8 A G 15: 52,333,575 D294G probably benign Het
Sox13 T C 1: 133,388,934 I212V probably benign Het
Srebf2 T A 15: 82,185,348 I657N possibly damaging Het
Srsf6 C A 2: 162,933,709 T146K probably benign Het
Strn4 T C 7: 16,824,163 V162A possibly damaging Het
Sulf2 T C 2: 166,132,605 D53G probably damaging Het
Tbc1d8 T A 1: 39,372,708 I1016F probably damaging Het
Tfrc G T 16: 32,618,657 A278S probably damaging Het
Tnrc6a T G 7: 123,184,289 probably null Het
Vmn1r83 T C 7: 12,321,768 I121V probably benign Het
Vps13d T C 4: 145,131,655 S2200G possibly damaging Het
Washc2 T A 6: 116,229,269 D397E probably damaging Het
Wipf3 T C 6: 54,485,555 L250P probably damaging Het
Xirp1 A G 9: 120,019,682 F45S probably damaging Het
Xpo5 A G 17: 46,236,963 T910A probably benign Het
Zfp235 T C 7: 24,141,676 Y507H probably damaging Het
Other mutations in Areg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Areg APN 5 91141095 missense probably damaging 0.99
IGL01929:Areg APN 5 91144453 missense probably benign
IGL01971:Areg APN 5 91141011 missense probably benign 0.03
IGL02250:Areg APN 5 91141108 missense possibly damaging 0.83
R1436:Areg UTSW 5 91139805 start gained probably benign
R1674:Areg UTSW 5 91143626 missense probably damaging 0.96
R1699:Areg UTSW 5 91143498 missense probably damaging 1.00
R4239:Areg UTSW 5 91143516 missense probably damaging 1.00
R4240:Areg UTSW 5 91143516 missense probably damaging 1.00
R4738:Areg UTSW 5 91146724 missense possibly damaging 0.91
R5040:Areg UTSW 5 91144339 missense possibly damaging 0.94
R5305:Areg UTSW 5 91144449 missense probably damaging 1.00
R5987:Areg UTSW 5 91146718 missense possibly damaging 0.83
R6075:Areg UTSW 5 91143597 missense probably damaging 0.99
R7210:Areg UTSW 5 91140905 nonsense probably null
R8165:Areg UTSW 5 91143633 missense probably damaging 0.97
R9054:Areg UTSW 5 91144358 missense probably damaging 1.00
R9498:Areg UTSW 5 91146694 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGTGCACTGCCCGATAGAG -3'
(R):5'- ACCTACTTGCATGTCACCAC -3'

Sequencing Primer
(F):5'- CCCGATAGAGCTATTCTGTGCAG -3'
(R):5'- TGCATGTCACCACCTCCAGG -3'
Posted On 2015-10-08