Incidental Mutation 'R3552:Gal3st1'
ID 269005
Institutional Source Beutler Lab
Gene Symbol Gal3st1
Ensembl Gene ENSMUSG00000049721
Gene Name galactose-3-O-sulfotransferase 1
Synonyms GalCer sulfotransferase, Gcst, Cst, galactosylceramide sulfotransferase, 3'-phosphoadenylylsulfate-galactosylceramide 3'-sulfotransferase
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3552 (G1)
Quality Score 220
Status Validated
Chromosome 11
Chromosomal Location 3983636-3999326 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3998110 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 106 (F106I)
Ref Sequence ENSEMBL: ENSMUSP00000105608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063004] [ENSMUST00000078757] [ENSMUST00000109981]
AlphaFold Q9JHE4
Predicted Effect possibly damaging
Transcript: ENSMUST00000063004
AA Change: F106I

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058348
Gene: ENSMUSG00000049721
AA Change: F106I

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078757
AA Change: F106I

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077815
Gene: ENSMUSG00000049721
AA Change: F106I

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109981
AA Change: F106I

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105608
Gene: ENSMUSG00000049721
AA Change: F106I

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 408 1.2e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121403
Meta Mutation Damage Score 0.7160 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfonation, an important step in the metabolism of many drugs, xenobiotics, hormones, and neurotransmitters, is catalyzed by sulfotransferases. This gene encodes galactosylceramide sulfotransferase, which catalyzes the sulfation of membrane glycolipids including the final step in the synthesis of sulfatide, a major lipid component of the myelin sheath. This gene exhibits elevated expression in ovarian epithelial carcinoma and the encoded enzyme exhibits elevated activity in renal cell carcinoma. Mutations in this gene may be associated with reduced insulin resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hindlimb weakness and progressive ataxia beginning at six weeks of age. Homozygous males exhibit sterility with a block in spermatogenesis prior to the first meiotic division. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Gal3st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gal3st1 APN 11 3999070 utr 3 prime probably benign
IGL01010:Gal3st1 APN 11 3996914 utr 5 prime probably benign
IGL01079:Gal3st1 APN 11 3998564 missense probably damaging 1.00
IGL01306:Gal3st1 APN 11 3998405 missense probably damaging 1.00
IGL01614:Gal3st1 APN 11 3998996 missense probably damaging 1.00
IGL01990:Gal3st1 APN 11 3998741 missense probably damaging 1.00
IGL02439:Gal3st1 APN 11 3998110 missense possibly damaging 0.95
R0306:Gal3st1 UTSW 11 3998546 missense probably damaging 1.00
R1075:Gal3st1 UTSW 11 3998509 missense possibly damaging 0.80
R1171:Gal3st1 UTSW 11 3998931 missense probably damaging 1.00
R1874:Gal3st1 UTSW 11 3998231 missense probably damaging 1.00
R2230:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2231:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2232:Gal3st1 UTSW 11 3998282 missense probably benign 0.31
R2985:Gal3st1 UTSW 11 3998618 missense probably damaging 1.00
R6737:Gal3st1 UTSW 11 3998903 missense probably benign 0.00
R7027:Gal3st1 UTSW 11 3999002 missense probably damaging 0.96
R7106:Gal3st1 UTSW 11 3998509 missense probably damaging 1.00
R7288:Gal3st1 UTSW 11 3998609 missense probably damaging 1.00
R7288:Gal3st1 UTSW 11 3998651 missense probably damaging 0.98
R7290:Gal3st1 UTSW 11 3998093 missense possibly damaging 0.70
R7438:Gal3st1 UTSW 11 3998227 missense probably benign 0.00
R7934:Gal3st1 UTSW 11 3998405 missense probably damaging 1.00
R9046:Gal3st1 UTSW 11 3998278 missense probably benign 0.05
R9475:Gal3st1 UTSW 11 3998660 missense probably damaging 1.00
RF020:Gal3st1 UTSW 11 3998153 missense possibly damaging 0.75
Z1088:Gal3st1 UTSW 11 3997984 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGTACTGTCACCCGCAAC -3'
(R):5'- CACCACGGATCCAAAGTAGTG -3'

Sequencing Primer
(F):5'- TGTCTCCTCCAGGACCTCAGAG -3'
(R):5'- AGCAGGGTCGCGGATGAC -3'
Posted On 2015-02-19